umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7087 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7087 and CGC66. hd7087 is a 442 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7098 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7098 and CGC66. hd7098 is a 5984 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7099 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7099 and CGC92. hd7099 is a 1508 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7083 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7083 and CGC66. hd7083 is a 1871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7091 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7091 and CGC66. hd7091 is a 5126 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7109 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7109 and CGC66. hd7109 is a 472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7100 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7100 and CGC66. hd7100 is a 572 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7101 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7101 and CGC66. hd7101 is a 1562 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1154 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCATCTTTTATATGCAAATATATTCCT; Right flanking sequence: CGTATGTGAAAGAATATGGAGAGGATCGGG. sgRNA #1: CATTATAAATTGTGGAAGGG; sgRNA #2: ATGCTTCAATCGTTGCTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7144 and CGC92. hd7144 is a 5280 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTGAAGAATAGCAGCAAAAACGGTCACCT; Right flanking sequence: ATTACTTTTTTTTAAAAAGTACAGTATCAA. sgRNA #1: ACAGGTGTTTACAATGCGAG; sgRNA #2: TATTTTCTTACAGTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced with hln1. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ homozygotes, and Unc homozygotes. Derived from parental strains VH7178 and PS1056. hd7179 is a deletion of 12118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGGCGAGGTAACGGGCGAATATTGCCG; Right flanking sequence: AACTGATTCTCAGTTAACCTAACCAATGAT. sgRNA #1: CAAACCCCGTACTTTTCAGG; sgRNA #2: AAGAAGTCGGGCTACTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7181 and CGC66. hd7181 is a 1382 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACTTCCTGCACCCAGAACTCATCAATTCCA; Right flanking sequence: AGCCATGCTAGAATTTCCTTTGGGTCCCCA. sgRNA #1: TCACTACTATTTACTCCACG; sgRNA #2: GGAAGTCTTGCATTAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

vkEx2883 [nhx-2p::aqp-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing AQP-1::CemOrange2 under the intestinal-specific nhx-2 promoter. AQP-1 is localized to the aprical and basal PM. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

Temperature sensitive Dpy. Nose touch defective (Not). Osmotic avoidance defective (Osm). Required for rapid glutamate-gated currents in the AVA interneurons. Null Allele.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).

RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.

RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.

maIs105 [col-19::GFP]. Retarded heterochronic phenotype. Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle. col-19::GFP expression is reduced in hyp7 at the L4 molt. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

maIs105 [col-19::GFP]. Retarded heterochronic phenotypes: extra seam cells and alae gaps in young adults. ma385 is a 1681 bp deletion of the lin-46 gene. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).

Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.

Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.

yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081

3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793

wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.

uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.

Unc. Sma. Reference: Craft TR & Forrester WC. Dev Biol.2017 Apr 1;424(1):18-27. PMID: 28238735

Heterozygotes are WT and segregate WT, dead eggs and Uncs. At 25C the Unc Spds are Sterile; at 16C the Unc Spds are fertile but produce mostly dead eggs. Unc Spd animals will exhibit a fully penetrant maternal-effect embryonic lethal phenotype if shifted to 25C at the L4 stage. unc-13 spd-2 homozygotes may be propagated at 16C but may become sick causing immense frustration! See also WBPaper00004200.

Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES-3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES=3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.

ojIs12 [cyk-4::GFP + unc-119(+)]. Strain is not very healthy. Described as integratred array but appears to segregate Uncs. Maintain at 15-20C.

Temperature sensitive - maintain at 16C. L1 shift-up to 25C produces incompletely penetrant sterile Unc phenotype. L4 shift-up produces leaky Mel phenotype. Unmapped.

GFP tag inserted at C-terminus of endogenous ahcy-1 locus. Derived by out-crossing parental strain PHX646 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.

Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.

High physiological germ-line apoptosis. op234 was originally assigned to gla-1, but cloning revealed it to be a point mutation in cpb-3 causing a C520Y substitution at an invariant cysteine within the conserved C/H domain.

opIs34 [hus-1p::hus-1::GFP + unc-119(+)]. Low-copy integrated array of 1144 bp hus-1 promoter and genomic coding sequence fused to GFP. Nuclear expression of GFP in germ cells and embryos. Integrated GFP construct completely rescues DNA damage induced cell cycle arrest defect and partially rescues DNA damage induced apoptosis of hus-1(op241).

Maintain at 15-20C. Sterile at 25C. Apoptosis variant. Small germ line.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

Non-Glp; remains fertile even with sygl-1(RNAi). Endogenous lst-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 5-6 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).

Non-Glp; remains fertile even with lst-1(RNAi). Endogenous sygl-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 10-12 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).