More Fields
Strain Species Genotype
AH12 C. elegans gap-1(ga133) X. Show Description
Null allele.
AH286 C. elegans unc-4(e120) ect-2(zh8) II; gap-1(ga133) X. Show Description
Muv and Unc. Semi-dominant mutation in ect-2 (previously called let-21).
ALF9 C. elegans unc-119(ed3) III; daf-12(rh61rh411) X; bafIs9. Show Description
bafIs9 [daf-12::TAP (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. TAP tag inserted into daf-12 fosmid. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
BN46 C. elegans npp-19(tm2886) II; bqIs7. Show Description
bqIs7 [pie-1p::LAP::npp-19 + unc-119(+)]; rescues Emb defects. Rodenas et al, Dev Biol. 2009 327:399-409.
BS3383 C. elegans pmk-3(ok169). Show Description
F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
CF1407 C. elegans daf-16(mu86) I; muIs71 X. Show Description
muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.
COP2412 C. elegans atg-9(ola511[delta AP]) V. Show Description
ola511 is aCRISPR-engineered allele deleting a conserved sorting motif in ATG-9, causing a 2- to 3-fold decrease in LGG-1-containing puncta (and therefore autophagosomes) in the AIY neurites. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10.
CP101 C. briggsae Cbr-puf-2(nm66)/Cbr-dpy-?(nm4) II. Show Description
Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.
DF5006 Rhabditella axei Show Description
0006. Rhabditella axei. Male/Female strain. Isolated by W. Sudhaus on July 29, 1979 from a compost heap in Esmoulieres, France. Grown easily on OP50 at 16-25C. See WBG 12(5) 14.
DF5010 Metarhabditis blumi Metarhabditis blumi wild isolate. Show Description
Metarhabditis blumi wild isolate. Formerly known as Rhabditis blumi. Isolated by J.P. Blum in April 1971 in a dung heap near Valencia, Spain. Gonochoristic. Grows well at 16-24C on OP50. Forms dauer larvae on overcrowded and starved plates. Freezes easily with C. elegans protocols with 80% viability.
DPX5454 C. elegans orn-1(tm5454) III. Show Description
Reference: Bailly AP, et al. Cell Rep. 2019 Oct 1;29(1):212-224.e8. doi: 10.1016/j.celrep.2019.08.070. PMID: 31577950
DR2278 C. elegans aap-1(m889) I. Show Description
Dauer formation at 27C. Long-lived. Maternal rescue.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
DV3313 C. elegans rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
ED3083 C. briggsae Show Description
Caenorhabditis briggsae wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Landscape: Urban_garden. Isolated from a compost sample from a private garden in Johannesburg, South Africa, March-April 06 by E. Dolgin. Same compost sample as ED3078-3089. WBPaper00035666. GPS: -26.200001 28.000000, Johannesburg, South Africa. Substrate: compost_heap. Sampled_by: Elie Dolgin WBPerson12345. 2006.
EM435 Oscheius myriophila Show Description
WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418.
EU1068 C. elegans unc-119(ed3) ruIs32 III; repo-1 (or430) IV; ruIs57. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EU2858 C. elegans repo-1(or430) IV; itIs153; ojIs1. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EV343 C. elegans unc-119(ed3); efEx12. Show Description
efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).
GG201 C. elegans ace-2(g72) I; ace-1(p1000) X. Show Description
Slow moving Unc. Cannot back. Hypercontracts when you tap nose.
GW1480 C. elegans bqsi433 II; bqSi495 IV; ygIs1. Show Description
bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
GW1482 C. elegans bqsi433 II; bqSi495 cec-4(ok3124) IV; ygIs1. Show Description
bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
GWJ1 C. elegans lap-1(pk486). Show Description
1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.
HZ504 C. elegans him-5(e1490) V; bpIs37. Show Description
bpIs37 [dcap-1p::dcap-1::DsRed + rol-6(su1006)]. Rollers. Translational DsRed reporter for the P body-specific marker dcap-1, which encodes the C. elegans ortholog of decapping complex component DCAP1. Low levels of expression are homogenously distributed in the cytoplasm at all stages of embryogenesis. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
HZ769 C. elegans him-5(e1490) V; bpIs88. Show Description
bpIs88 [tia-1p::tia-1::GFP + dcap-1p::dcap-1::RFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
IT540 C. elegans gap-3(kp1) I; puf-8(zh17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are wild type and segregate wild type heterozygotes, paralyzed DpyUncs, and Uncs with germline tumors. Pick WT and check segregation of progeny to maintain. Reference: Vaid S, et al. Development. 2013 Apr;140(8):1645-54.
JH1964 C. elegans unc-119(ed3) III; axIs1427. Show Description
axIs1427 [pCG26/ LAP-tag DCP-1]. Reference: Gallo CM, et al. Dev Biol. 2008 Nov 1;323(1):76-87.
JH1986 C. elegans unc-119(ed3) III; axIs1437. Show Description
axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH2078 C. elegans unc-119(ed3) III; axIs1504. Show Description
axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2099 C. elegans unc-119(ed3) III; axIs1486. Show Description
axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH2100 C. elegans unc-119(ed3) III; axIs1487. Show Description
axIs1487 [pCG81; pie-1p::LAP::patr-1 + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Maintain @ 25C; array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH2171 C. elegans unc-119(ed3) III; axIs1586. Show Description
axIs1586 [pie-1::LAP::glh-1::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in P-granules of distal germline.
JH2281 C. elegans unc-119(ed3) III; axIs1729. Show Description
axIs1729 [pie-1p::LAP tag::mCherry::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2458 C. elegans unc-119(ed3) III; axIs1735. Show Description
axIs1735 [pie-1p::LAP tag::npp-10 (full length) + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2835 C. elegans pptr-1(tm3103) V; axIs1504. Show Description
axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JN147 C. elegans gap-2(tm748) X. Show Description
No apparent phenotype. tm748 is a UV/TMP-induced gap-2 deletion allele generated by National Bioresource Project (see http://shigen.lab.nig.ac.jp/c.elegans/index.jsp?lang=englis h for info).
JS803 C. elegans unc-119(ed3) III; vwIs346. Show Description
vwIs346 [pie-1p::LAP::CDC-48.2 + unc-119(+)].
JU1200 C. elegans Show Description
Isolated by Tony Page from a compost heap sample recovered on 1 Aug 2007 in SouthWest Scotland 4°36.0' West 55°34.6' North.
JU1615 C. elegans Show Description
Isolated by Matthew Crook from compost heap, 13 Cherry St., Macleod, Melbourne, Australia, March 2009. *** NOTE: JU1615 is probably a N2 contaminant and not a real wild isolate. This is inferred from genotyping data from Erik Andersen et al. in the Kruglyak lab. (M-A Felix, Dec 2010).
JU360 C. elegans Show Description
Isolated by Marie-Anne Felix. Franconville (Val d'Oise), France, in a compost heap in Claude Pieau's gargen, on September 16, 2002.
JU361 C. elegans Show Description
Isolated by Marie-Anne Felix. Franconville (Val d'Oise), France, in a compost heap in Claude Pieau's gargen, on September 16, 2002.
JU362 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.
JU363 C. elegans Show Description
Isolated by Marie-Anne Felix. Franconville (Val d'Oise), France, in a compost heap in Claude Pieau's gargen, on September 16, 2002.
JU364 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.
JU365 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.
JU366 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.
JU367 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.
JU368 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.
JU369 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.
JU370 C. elegans Show Description
C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.