Null allele.

Muv and Unc. Semi-dominant mutation in ect-2 (previously called let-21).

bafIs9 [daf-12::TAP (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. TAP tag inserted into daf-12 fosmid. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.

bqIs7 [pie-1p::LAP::npp-19 + unc-119(+)]; rescues Emb defects. Rodenas et al, Dev Biol. 2009 327:399-409.

F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.

muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.

ola511 is aCRISPR-engineered allele deleting a conserved sorting motif in ATG-9, causing a 2- to 3-fold decrease in LGG-1-containing puncta (and therefore autophagosomes) in the AIY neurites. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10.

Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.

0006. Rhabditella axei. Male/Female strain. Isolated by W. Sudhaus on July 29, 1979 from a compost heap in Esmoulieres, France. Grown easily on OP50 at 16-25C. See WBG 12(5) 14.

Metarhabditis blumi wild isolate. Formerly known as Rhabditis blumi. Isolated by J.P. Blum in April 1971 in a dung heap near Valencia, Spain. Gonochoristic. Grows well at 16-24C on OP50. Forms dauer larvae on overcrowded and starved plates. Freezes easily with C. elegans protocols with 80% viability.

Reference: Bailly AP, et al. Cell Rep. 2019 Oct 1;29(1):212-224.e8. doi: 10.1016/j.celrep.2019.08.070. PMID: 31577950

Dauer formation at 27C. Long-lived. Maternal rescue.

Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.

Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.

Caenorhabditis briggsae wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Landscape: Urban_garden. Isolated from a compost sample from a private garden in Johannesburg, South Africa, March-April 06 by E. Dolgin. Same compost sample as ED3078-3089. WBPaper00035666. GPS: -26.200001 28.000000, Johannesburg, South Africa. Substrate: compost_heap. Sampled_by: Elie Dolgin WBPerson12345. 2006.

oxIs609 [acr-5p::GAP-43::GFP + lin-15(+)] X. GFP localized to axonal membranes of acr-5 expressing neurons. acr-5 promoter drives expression of reporter containing 40 aa myristoylation sequence of GAP43 fused to GFP. oxIs609 was generated by X-ray integration of oxEx81in N2 background. Reference: Rawson RL, et al. Curr Biol. 2014 Mar 31;24(7):760-5. doi: 10.1016/j.cub.2014.02.025. PMID: 24631238.

WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418. Formerly known as Oscheius myriophila.

fphIs1 [aak-2Ap::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed with its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx3 [aak-2Ap::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2c isoform expressed from the aak-2a promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.

efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).

Slow moving Unc. Cannot back. Hypercontracts when you tap nose.

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.

bpIs37 [dcap-1p::dcap-1::DsRed + rol-6(su1006)]. Rollers. Translational DsRed reporter for the P body-specific marker dcap-1, which encodes the C. elegans ortholog of decapping complex component DCAP1. Low levels of expression are homogenously distributed in the cytoplasm at all stages of embryogenesis. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.

bpIs88 [tia-1p::tia-1::GFP + dcap-1p::dcap-1::RFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.

Heterozygotes are wild type and segregate wild type heterozygotes, paralyzed DpyUncs, and Uncs with germline tumors. Pick WT and check segregation of progeny to maintain. Reference: Vaid S, et al. Development. 2013 Apr;140(8):1645-54.

axIs1427 [pCG26/ LAP-tag DCP-1]. Reference: Gallo CM, et al. Dev Biol. 2008 Nov 1;323(1):76-87.

axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1487 [pCG81; pie-1p::LAP::patr-1 + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Maintain @ 25C; array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1586 [pie-1::LAP::glh-1::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in P-granules of distal germline.

axIs1729 [pie-1p::LAP tag::mCherry::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.

axIs1735 [pie-1p::LAP tag::npp-10 (full length) + unc-119(+)]. Maintain at 25C to maintain transgene expression.

axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

SNAP tag inserted into endogenous pgl-1 locus between G713 and G714.

No apparent phenotype. tm748 is a UV/TMP-induced gap-2 deletion allele generated by National Bioresource Project (see http://shigen.lab.nig.ac.jp/c.elegans/index.jsp?lang=englis h for info).

vwIs346 [pie-1p::LAP::CDC-48.2 + unc-119(+)].

Isolated by Tony Page from a compost heap sample recovered on 1 Aug 2007 in SouthWest Scotland 4°36.0' West 55°34.6' North.

Isolated by Matthew Crook from compost heap, 13 Cherry St., Macleod, Melbourne, Australia, March 2009. *** NOTE: JU1615 is probably a N2 contaminant and not a real wild isolate. This is inferred from genotyping data from Erik Andersen et al. in the Kruglyak lab. (M-A Felix, Dec 2010).

Isolated by Marie-Anne Felix. Franconville (Val d'Oise), France, in a compost heap in Claude Pieau's gargen, on September 16, 2002.

Isolated by Marie-Anne Felix. Franconville (Val d'Oise), France, in a compost heap in Claude Pieau's gargen, on September 16, 2002.

C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.

Isolated by Marie-Anne Felix. Franconville (Val d'Oise), France, in a compost heap in Claude Pieau's gargen, on September 16, 2002.

C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.

C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.

C. elegans wild isolate. Isolated in Franconville (Val d Oise), France on September 16, 2002 from a compost heap in Claude Pieau's garden.