mNeonGreen and AID tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.

Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.

GFP and AID tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206.

3xFLAG, mNeonGreen, and AID tags inserted into endogenous mab-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.

AID::mScarlet tag inserted into endogenous dve-1 locus via CRISPR/Cas9 engineering. Reference: Alexander, K.D. et al. Nat Commun 2023 Nov 18;14(1):7520. PMID: 37980357.

syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024].

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of unc-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of bnc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.

H34C03.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1817 homozygotes (sterile adult, no eggs laid). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTCTCGAAATCCCGTTTG. External right primer: TTTTTCCGGGTCTTACAACG. Internal left primer: ATCGATCCATCGGAACACAT. Internal right primer: TTCAGTGTCTGCCAAAATGC. Internal WT amplicon: 2615 bp. Deletion size: 1056 bp. Deletion left flank: TCTTTCAATTAAAACTTCAAAAATAGATTT. Deletion right flank: ACTGAAAATTGAGGAAATTCAAGAAGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Can be used in conjunction with tissue-specific TIR1-expressing lines to degrade RAGA-1 protein via the Auxin Inducible Degron system. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.

wbmIs83 [rab-3p::3xFlag::TIR1::rab-3 3'UTR] *wbmIs66 IV. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Neuronal-specific expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the nervous system. wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195

Auxin-Inducible Degron (AID) tag was inserted into the endogenous let-363 coding sequence via CRISPR/Cas9. This strain can be combined with TIR1-expressing strains to induce degradation of LET-363. Reference: Smith HJ, et al. PLoS Genetic. 2023 Sep 18;19(9):e1010938. doi: 10.1371/journal.pgen.1010938. PMID: 37721956.

Engineered Y145C substitution mutation in endogenously GFP-tagged ahcy-1 locus. ahcy-1(Y145C) mutation mimics the pathogenic human mutation AHCY Y143C. ahcy-1(Y145C) mutants have a prolonged lifespan and are larger than control animals. ahcy-1(Y145C) mutants are fertile and produce a brood of laid and hatched eggs similar to control animals. ahcy-1(Y145C) mutants show a slight increase in SAH and a decrease in SAM levels, leading to an increased SAH to SAM ratio. See WOP122 for control strain. Derived by out-crossing parental strain PHX784 two times to N2. Reference: Thapa P, et al. NPJ Aging. 2023 Dec 5;9(1):27. doi: 10.1038/s41514-023-00125-1. PMID: 38052822.

osIs158 [eft-3p::AtTIR1(F79G)::mRuby] II. Single copy insertion into ttTi5605 on LG II. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.

jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.