| MQD2499 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; hqSi10 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the body wall muscles.
hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| MQD2500 |
C. elegans |
daf-16(hq389[daf-16::gfp::AID*]) I; hqSi11 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and AID* inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the gonadal sheath.
hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
|
|
| NK2225 |
C. elegans |
unc-59(qy50[unc-59::GFP::3xflag::AID*]) I. Show Description
CRISPR/Cas9-engineered insertion of GFP::3xflag::AID* tags into endogenous unc-59/septin locus. Reference: Chen D et al. MicroPubl Biol. 2019 Dec 20;2019:10.17912/micropub.biology.000200. doi: 10.17912/micropub.biology.000200. PMID: 32550451.
|
|
| OH13988 |
C. elegans |
ieSi57 II; unc-3(ot837[unc-3::mNeonGreen::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID* degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T, Hobert O. Elife. 2017 Apr 19;6:e24100. doi: 10.7554/eLife.24100. PMID: 28422646.
|
|
| OH14070 |
C. elegans |
bnc-1(ot845[bnc-1::mNeonGreen::AID*]) V. Show Description
bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID*). Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346
|
|
| OH14125 |
C. elegans |
daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID*]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID* at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
|
|
| OH14357 |
C. elegans |
mab-9(ot863[mab-9::TagRFP::AID*]) II. Show Description
mab-9(ot863[mab-9::TagRFP::AID*]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID*). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346
|
|
| OH14654 |
C. elegans |
daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva U. et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586; PMCID: PMC8099054.
|
|
| OH14888 |
C. elegans |
daf-16(ot853[daf-16::mNG::3xFlag::AID*]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva U et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14891 |
C. elegans |
daf-12(ot874[daf-12::TagRFP::3xFlag::AID*]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-12 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14896 |
C. elegans |
daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-3 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14897 |
C. elegans |
daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14945 |
C. elegans |
daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14946 |
C. elegans |
ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14984 |
C. elegans |
daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14986 |
C. elegans |
ieSi57 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH14989 |
C. elegans |
ieSi60 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. Show Description
ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH15227 |
C. elegans |
unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.
|
|
| OH15439 |
C. elegans |
ceh-34(ot903[ceh-34::mNG::3xFLAG::AID*]) V. Show Description
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID* tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| OH15845 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH15913 |
C. elegans |
daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH16029 |
C. elegans |
daf-16(ot975[daf-16::mNeptune2.5::AID*]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID*. Reference: Aghayeva U, et al. MicroPubl Biol. 2020 Jan 7;2020:10.17912/micropub.biology.000210. doi: 10.17912/micropub.biology.000210. PMID: 32550509
|
|
| OH16508 |
C. elegans |
daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID*]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH17582 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II; daf-2(e1370) III. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19078 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otIs908 V. Show Description
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19232 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OS13059 |
C. elegans |
ieSi57 II; osm-6(syb2906[osm-6::linker::GFP::AID]) V. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Endogenous osm-6 locus tagged with GFP and AID allows for inducible cilia disruption upon application of auxin. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
|
|
| OS13359 |
C. elegans |
osm-6(syb4401[osm-6::linker::AID *syb2906]) V; vap-1(ns831[vap-1::sfGFP]) X. Show Description
Endogenous osm-6 locus tagged with AID allows for inducible disruption of cilia in the presence of TIR1 and application of auxin. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
|
|
| PH13 |
C. elegans |
rad-8(mn163) I. Show Description
UV Hypersensitive. Eggs laid early in adulthood: 100% inviable. Eggs laid late in adulthood: 70% viable.
|
|
| PHX1812 |
C. elegans |
cfi-1(syb1812[cfi-1(delta_enhancer)::mNG::AID*]) I. Show Description
A4e enhancer was deleted in endogenously-tagged cfi-1(kas16[mNG::AID*::cfi-1]). Expression of cfi-1::mNG::AID* is lost in VNC motor neurons. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
|
|
| PHX1856 |
C. elegans |
cfi-1(syb1856[cfi-1(mut_COE)::mNG::AID*) I. Show Description
Eight COE motifs in A4e were mutated in endogenously-tagged cfi-1(kas16[mNG::AID*::cfi-1]). Expression of cfi-1::mNG::AID* is down-regulated in late larval stages and adults. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
|
|
| PHX2307 |
C. elegans |
ceh-13(syb2307[ceh-13::mNG::AID*]) III. Show Description
mNeonGreen and AID* tags inserted into endogenous ceh-13 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
|
|
| PHX2361 |
C.elegans |
egl-5(syb2361[egl-5::mNG::3xFLAG::AID*]) III. Show Description
mNeonGreen::3xFLAG::AID* tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
|
|
| PHX5755 |
C. elegans |
pha-4(ot946 ot1078 syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG]) V. Show Description
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PHX5791 |
C. elegans |
pop-1(syb5791[GFP::AID*::GGGGSGSGS linker::pop-1]) I. Show Description
GFP and AID* tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.
|
|
| PHX6129 |
C. elegans |
ieSi57 II; Y47D3A.21(syb6129[GFP::AID*:::3Xflag::3xGAS::Y47D3A.21]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID*, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206.
|
|
| PHX6730 |
C.elegans |
mab-5(syb6730[mab-5::3xFLAG::mNG::AID*)]) III. Show Description
3xFLAG, mNeonGreen, and AID* tags inserted into endogenous mab-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
|
|
| PHX7515 |
C elegans |
dve-1(syb7515[dve-1::AID*::mScarlet]) X. Show Description
AID*::mScarlet tag inserted into endogenous dve-1 locus via CRISPR/Cas9 engineering. Reference: Alexander, K.D. et al. Nat Commun 2023 Nov 18;14(1):7520. PMID: 37980357.
|
|
| PS10501 |
C. elegans |
pam-1(sy2224) IV. Show Description
Superficially wild-type but reduced brood size/early eggs laid/fewer viable eggs. CRISPR/Cas9 engineered STOP-IN null mutant of pam-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTTCAGAATGGCGGCCTGTGGAAACCCAAGCG. right flanking sequence: CGGCGGTCAAATTTGAGAGGCTTCCAACATTCGCC. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTGGAAACCCAAGCGCGG. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS10640 |
C. elegans |
cmk-1(sy2277[cmk-1::mKate2::AID*::3xFLAG) IV; syIs875. Show Description
syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID*::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024].
|
|
| PX624 |
C. elegans |
fxSi1 I; spe-44(fx123[spe-44::AID*]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
|
|
| PX627 |
C. elegans |
fxIs1 I; spe-44(fx110[spe-44::AID*]) IV. Show Description
fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.
|
|
| PX629 |
C. elegans |
fxIs1 I; spe-44(fx110[spe-44::AID*]) IV; him-5(e1490) V. Show Description
fxIs1 [pie-1p::TIR1::mRuby, I:2851009] I. Auxin-inducible spermatogenesis arrest, resulting in hermaphrodite self-sterility and reversible male sterility. Him: males produced at ~30%. AID* tag was inserted into the endogenous spe-44 locus. Reference: Kasimatis KR, et al. (2018) Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegans. BioRvix. doi: https://doi.org/10.1101/284232.
|
|
| PX658 |
C. elegans |
fxSi1 I; fxSi4 II; fxSi6 III; spe-44(fx123[spe-44::AID*]) IV; fog-2(fx111) V. Show Description
fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605
|
|
| RAF2181 |
C. elegans |
ieSi57 II; daf-2(bch-40[AID*::3xFLAG::STOP::SL2::SV40::AID*::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
|
|
| RJP5269 |
C. elegans |
unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635
|
|
| RJP5296 |
C. elegans |
reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| SUR54 |
C. elegans |
wrdSi23 I; rubSi6 II; rubSi8[*rubSi7] IV; ltIs44 V. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3UTR] II. rubSi8 [eft-3p::24xGCN4::AID::T2A::tagBFP::H2B::tbb-2 3UTR *rubSi7]) IV. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. SunTag system allows visualization of translation throughout development in real-time. In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, bright clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters in the absence of auxin, but not in the presence of auxin. Bright BFP signal from mTagBFP2::AID*::NLS and TagBFP::H2B can be visible in nuclei in the absence of auxin, in the presence of auxin only dimmer TagBFP::H2B is visible in nuclei. mCherry::PH marks the cell membranes throughout development. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3UTR) downstream of the tbb-2 3UTR in the intact transgene. rubSi8 derived by modification of insertion of an AID tag into rubSi7, which is located in cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
|
|
| SYS148 |
C. elegans |
ujIs113 II; unc-3(ot837([unc-3::mNeonGreen::AID*]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of unc-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| SYS149 |
C. elegans |
ujIs113 II; bnc-1(ot845([bnc-1::mNeonGreen::AID*]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of bnc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|