hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

CRISPR/Cas9-engineered insertion of GFP::3xflag::AID tags into endogenous unc-59/septin locus. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000200/

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T & Hobert O. eLife 2017.

bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID). Reference: Kerk SY, et al. Neuron 2017 (in press).

mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580

mab-9(ot863[mab-9::TagRFP::AID]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron 2017 (in press).

Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted

Superficially wildtype. CRISPR/Cas9-engineered AID conditional daf-12 allele. Reference: Aghayeva et al., submitted

Superficially wildtype. CRISPR/Cas9-engineered AID conditional daf-3 allele. Reference: Aghayeva et al., submitted

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted

ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted

ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted

Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al., submitted

ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted

ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted

unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).

CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted

otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted

CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.

otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted

UV Hypersensitive. Eggs laid early in adulthood: 100% inviable. Eggs laid late in adulthood: 70% viable.

A4e enhancer was deleted in endogenously-tagged cfi-1(kas16[mNG::AID::cfi-1]). Expression of cfi-1::mNG::AID is lost in VNC motor neurons. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.

Eight COE motifs in A4e were mutated in endogenously-tagged cfi-1(kas16[mNG::AID::cfi-1]). Expression of cfi-1::mNG::AID is down-regulated in late larval stages and adults. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.

Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.

GFP and AID tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of unc-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of bnc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.

H34C03.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1817 homozygotes (sterile adult, no eggs laid). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTCTCGAAATCCCGTTTG. External right primer: TTTTTCCGGGTCTTACAACG. Internal left primer: ATCGATCCATCGGAACACAT. Internal right primer: TTCAGTGTCTGCCAAAATGC. Internal WT amplicon: 2615 bp. Deletion size: 1056 bp. Deletion left flank: TCTTTCAATTAAAACTTCAAAAATAGATTT. Deletion right flank: ACTGAAAATTGAGGAAATTCAAGAAGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

osIs158 [eft-3p::AtTIR1(F79G)::mRuby] II. Single copy insertion into ttTi5605 on LG II. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.

jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.