| AA86 |
C. elegans |
daf-12(rh61rh411) X. Show Description
Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele. |
|
| MAA16 |
C. elegans |
baIs11 IV; cul-5(ok1706) V. Show Description
baIs11 [dat-1p::GFP + dat-1p::alpha-synuclein] IV. [NOTE: baIs11 was originally publised as baIn11 due to a typographical error that has persisted.] Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
|
| OD63 |
C. elegans |
unc-119(ed3) III; ltIs43/+. Show Description
ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain. |
|
| RG3381 |
C. elegans |
Y38C1AA.6(ve881[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 851 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGAACAATGTTTCGATCAAAAACATTCCC ; Right flanking sequence: CGGTGTTGGAGTGTTTCAATGAAGATGATG. Y38C1AA.6 sgRNA #1: GTTGCAAATTGGGCATGAAG; Y38C1AA.6 sgRNA #2: AGATTTCCAACTTATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
