More Fields
Strain Species Genotype
RA334 C. elegans unc-119(ed3) III; him-5(e1490) V; rdIs26. Show Description
rdIs26 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.
RA335 C. elegans unc-119(ed3) III; him-5(e1490) V; rdIs27. Show Description
rdIs27 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.
RB1012 C. elegans egl-8(ok934) V. Show Description
B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1145 C. elegans ags-3(ok1169) X. Show Description
F32A6.4a Homozygous. Outer Left Sequence: ctccggttttaaatttggca. Outer Right Sequence: acgttgggttttgagcattc. Inner Left Sequence: ttcgcgatgctcaatatcag. Inner Right Sequence: caaagacgttttgcgactca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1178 C. elegans wwp-1(ok1102) I. Show Description
Y65B4BR.4a. Homozygous. Outer Left Sequence: AACGAAGAAGCGCAGGAGTA. Outer Right Sequence: CAATCGTCCACATCAACGTC. Inner Left Sequence: AGTTCAGAGGCATCCACGTC. Inner Right Sequence: ATCTCTGTACCGCCCTCCTT. Inner Primer PCR Length: 3219 bp. Deletion Size: 1042 bp. Deletion left flank: GCGGAGACCGGCGACAGCGAAGCGTGACAC. Deletion right flank: ACTCAGCCATTGCCACAGGGATGGGAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1208 C. elegans mrt-2(ok1260) III. Show Description
Y41C4A.14 Homozygous. Outer Left Sequence: tcacgcaatcagtgagcttc. Outer Right Sequence: accgagcattttattcgacg. Inner Left Sequence: gtgcgatggcctacaaaact. Inner Right Sequence: ctcggggatcgaacattaaa. Inner Primer PCR Length: 3107. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1875 C. elegans Y65B4A.3(ok2425) I. Show Description
Y65B4A.3. Homozygous. Outer Left Sequence: ACCTCCTCAGACGACTCGAA. Outer Right Sequence: GAGCGCGAAAATTCAAAGAG. Inner Left Sequence: GTCGCCATATCGTCGTTTTT. Inner Right Sequence: CCGATTTTAGAGGAAGACCAGA. Inner Primer PCR Length: 3213 bp. Deletion Size: 1830 bp. Deletion left flank: CATGGTTTCCGACTGTTTTTCCTGTTAAAT. Deletion right flank: TTTTTTCCACATGTGTGGATCTCAATTTAT. Insertion Sequence: GTTAAAAAATGTATGAAAAAAAATTTTAAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2263 C. elegans Y23B4A.2(ok3065) X. Show Description
Y23B4A.2. Homozygous. Outer Left Sequence: TCGGCATTCTGTTAGGAAGC. Outer Right Sequence: ACGGAACAGATCTCCTCGAA. Inner Left Sequence: GACCGTAATCCCGTTCACAA. Inner Right Sequence: TGTATTTTGGTAACGCGTCG. Inner Primer PCR Length: 1292 bp. Deletion Size: 598 bp. Deletion left flank: TTCCTTTTCTGTCTTTTATTAATTTCCTTT. Deletion right flank: AAAATTTTGTTTTTCAGTAACAATTCCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2363 C. elegans Y51H4A.13(ok3209) IV. Show Description
Y51H4A.13 Homozygous. Outer Left Sequence: aagccagtagatgtcgggtg. Outer Right Sequence: gccagaaccctgtgaatgat. Inner Left Sequence: tacagcgtccgacatctcac. Inner Right Sequence: tcgaattttcgacaaatcaataa. Inner Primer PCR Length: 1264. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2384 C. elegans Y34B4A.8(ok3242) X. Show Description
Y34B4A.8 Homozygous. Outer Left Sequence: ttatgggggatgaagctttg. Outer Right Sequence: tggagtaccccttgatgagc. Inner Left Sequence: aaatttcagtcatttggccg. Inner Right Sequence: cgattcaaaaagaaagaatatccg. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2523 C. elegans Y34B4A.4(ok3499) X. Show Description
Y34B4A.4 Homozygous. Outer Left Sequence: ggtcttgccacgatttcagt. Outer Right Sequence: taaaaaccgctcaacctcca. Inner Left Sequence: agctgctgttcttgaagctg. Inner Right Sequence: gctcacattgcatcgtgtaaa. Inner Primer PCR Length: 1120. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2527 C. elegans Y39E4A.2(ok3503) III. Show Description
Y39E4A.2 Homozygous. Outer Left Sequence: cccgccaaaaattattcaga. Outer Right Sequence: accgtaatgggacagacagc. Inner Left Sequence: atttccggccaaaaattgat. Inner Right Sequence: tcagaattcagtgttaccgca. Inner Primer PCR Length: 1229. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB525 C. elegans pgl-3(ok257) V. Show Description
C18G1.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB776 C. elegans kin-32(ok166) I. Show Description
C30F8.4a. Homozygous. Outer Left Sequence: gacaagtttgttctgtcccat. Outer Right Sequence: cgtcatgttcctatatgctca. Inner Left Sequence: tgtctgtcacgagcataaatc. Inner Right Sequence: ttcttggaatacggtccttgt. Inner primer WT PCR product: 3500. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB796 C. elegans sta-1(ok587) IV. Show Description
Y51H4A.17. Homozygous. Outer Left Sequence: AATTTCCAGACATGATGGGC. Outer Right Sequence: GCAATACGACTTGCCAGTGA. Inner Left Sequence: GCAGCCACACTTTATGAGCA. Inner Right Sequence: AAAGGTGCCAAATGAAATGG. Inner primer WT PCR product: 2902. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB912 C. elegans ddx-19(ok783) II. Show Description
T07D4.4a. Homozygous. Outer Left Sequence: CCAGTAATGCTCCACCACCT. Outer Right Sequence: CGTGTGACAGAAAATGACGG. Inner Left Sequence: GGAGTTTTAGCCCCGAGAAC. Inner Right Sequence: CGACAGCGAGTCCACTGTAA. Inner Primer WT PCR product: 3113. Deletion size: 1107 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3187 C. elegans Y41D4A.6(ve687[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 Show Description
Homozygous sterile. Deletion of 4404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+
RW11448 C. elegans unc-119(tm4063) III; stIs11448. Show Description
stIs11448 [nhr-34a::H1-wCherry + unc-119(+)].
RW11703 C. elegans unc-119(tm4063) III; stIs11703. Show Description
stIs11703 [R08E3.4a::H1-wCherry + unc-119(+)].
RW11784 C. elegans unc-119(tm4063) III; stIs11784. Show Description
stIs11784 [C27D6.4a.1::H1-wCherry + unc-119(+)].
SP346 C. elegans 4n (tetraploid). Show Description
TETRAPLOID 4A:4X PICK LARGE TO MAINTAIN
TG4298 C. elegans lem-3(gt3310[eGFP::STag::lem-3[S192A S194A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in putative phosphorylation sites [S192 S194]. Homozygous viable, though [S192A S194A] mutants exhibit increased embryonic lethality after irradiation. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
UTR43 C. elegans par-4(nar12[par-4Ap::mNG + loxP sqt-1(gf) Hygromycin(+) loxP 3X FLAG]) V. Show Description
Homozygous viable, Rol. nar12 (non-excised strain) is null for par-4A & C, but not for par-4B, and is viable. Low rate of spontaneous excision even when maintained at 15C. Pick Rollers to maintain. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
UTR45 C. elegans par-4(nar13[mNG::3X FLAG::par-4a + loxP]) V. Show Description
Superficially wild-type. nar13 was derived by excision of UTR43(nar12) cassette by heat shock. Tagged endogenous PAR-4A & C: weak, ubiquitous fluorescence. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
VC1318 C. elegans Y65B4A.2(ok1809) I. Show Description
Y65B4A.2. Superficially wild type. External left primer: TGATGACTTCCACACGGTTC. External right primer: CGTTCAGCTTCTCGGTTTTC. Internal left primer: TTCGACAAAACATGGTGCAT. Internal right primer: TACTCGTTCCTTTCCATCGG. Internal WT amplicon: 3406 bp. Deletion size: 1338 bp. Deletion left flank: TATCGATTTTTTCCGATAATTATCGATTTT. Deletion right flank: TCCGATAATAATCGACTTTTCCGATAGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1699 C. elegans Y51H4A.18(gk809) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 265 bp. Deletion left flank: CCAAGGCAGATTTGTGAATGAACTCGGCGA. Deletion right flank: ATTAAAAATGTTTACTTTACTTATTTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1704 C. elegans set-26&Y51H4A.15(ok2136) IV/nT1 [qIs51] (IV;V). Show Description
Y51H4A.12, Y51H4A.15. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2136 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCCATTCCACCAATTCCA. External right primer: TTGAAAAATCGGCTTTCAGG. Internal left primer: ACTCCACTTGATTTCCACCG. Internal right primer: AAATTCCTCGCTTTTCGTCA. Internal WT amplicon: 2473 bp. Deletion size: 1621 bp. Deletion left flank: CTTCTGTCGGGAGAATGATTCGGTCCGCGG. Deletion right flank: CAAATATCCTGTATCACGATTTCGACCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1761 C. elegans Y51H4A.18(gk850) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 435 bp. Deletion left flank: CTTAAAGTATACGTCGATTCTGAAAATACACTGAAAATGAAAT. Deletion right flank: TACAGGTTGGTACTTCTACTATGAAAAAAT. Insertion Sequence: TTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1803 C. elegans Y51H4A.18(gk868) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 472 bp. Deletion left flank: AGTCATTGCACAGCTGGAACAGCAACAGAGACTAGAAAAT. Deletion right flank: ATGATTTTTTCTTGGCTTAAACGATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1830 C. elegans rho-1(ok2418) IV/nT1 [qIs51] (IV;V). Show Description
Y51H4A.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2418 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGGAGAGGAGATGTGTGAT. External right primer: GCAAATCCAGGTTTTTCCCT. Internal left primer: ATTGGAATAGAGAAGCGCGA. Internal right primer: TTTTCACCCGAAAATCCAGA. Internal WT amplicon: 3317 bp. Deletion size: 2091 bp. Deletion left flank: ATTTGGGGGAAAATTAGATGAACTTTTGTT. Deletion right flank: AAAAAACTTAAATTTTCAGCAAAAATTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2476 C. elegans Y43D4A.6(gk1142) IV. Show Description
Y43D4A.6. Identified by PCR, validated by CGH. External left primer: ACGATAAACCAGCAGACGCT. External right primer: TTTGAAAACGGTGTGAAACG. Internal left primer: AACTGTGTTCGAAACCCTCG. Internal right primer: TCAAGCTCATTCGGATTTCA. Internal WT amplicon: 2337 bp. Deletion size: 1390 bp. Deletion left flank: CAAGTTTATCAACAACGTGAAACAGACAAT. Deletion right flank: CAGCAAAAAAATCACTTGCTCCAGTAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2527 C. elegans +/mT1 II; Y39E4A.3(ok2650)/mT1 [dpy-10(e128)] III. Show Description
Y39E4A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2650 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTGGAGCGTAATTTTTCA. External right primer: CGACATTTTGCGGACTTTTT. Internal left primer: GGCACGGTTTTCCTCTTTTT. Internal right primer: GTGGCTGGTGATTTTTCCAC. Internal WT amplicon: 1226 bp. Deletion size: 520 bp. Deletion left flank: TTTCTCCAGAAATATCGATTTTTTAAAAGC. Deletion right flank: CGGAAAGCGTCTCCTTCAACGGTAGAAGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3023 C. elegans srx-4(ok3715) V. Show Description
Y49C4A.5. External left primer: TTTGCCAAACTGACGTCTTG. External right primer: AATTCTCCAGGTGGTCATGG. Internal left primer: AAGGATGGTTCAGGCTTCAT. Internal right primer: CGCAAGCGCTACAGTAGTCA. Internal WT amplicon: 1157 bp. Deletion size: 582 bp. Deletion left flank: TGAATCCCAAATAAATTATTGCATTGGAAG. Deletion right flank: CAAAAAACTCACCATAACGTAGAAAAACGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3127 C. elegans Y41D4A.5(gk3186) IV. Show Description
This strain is homozygous for a deletion (gk3186) in Y41D4A.5, detectable by PCR using the following primers. External left primer: TTTTTATCAGGTGGAAAATGGG. External right primer: GTTATTCGTGTGTTGCCTTGAA. Internal left primer: CGGAGAAAAATTGTGTGGAAA. Internal right primer: TTTCTTCATTTCTCAGCCGAA. Internal WT amplicon: 784 bp. Deletion size: 232 bp. Deletion left flank: AATTCGTGTTTTTTAGCCTAAATTTTCGCT. Deletion right flank: TCAAGTTTTTCAGTGAAAAATTTGAAAAAA. Validation: gk3186 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4259 C. elegans Y51H4A.23(gk5343[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 812 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAATTAATACAACCGCAAAAGTTTGGG; Right flanking sequence: CGAGGAATAAAGATTTGAAAATTGATTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4333 C. elegans Y65B4A.6(gk5416[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 638 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAACCAGTCCACCTTTCTACGTGTATTACA. Right flanking sequence: CGGGGATGGCGCGTTGCTGGATGGCAGATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4371 C. elegans Y41C4A.7(gk5452[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 751 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACATCACGAATTTGTCGCCGTTTCCGGTT; Right flanking sequence: TCAACGGGTAAGTCTTGTGTGCCTGCCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4781 C. elegans Y65B4A.8(gk5849[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3386 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACGGTCCACGTTTCGGCGAGCGTTTTGTG. Right flanking sequence: CGGCTGCGCGTCTCTATTTCACACACTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC490 C. elegans lin-40(gk255) IV/nT1 [qIs51] (IV;V). Show Description
T27C4.4a. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk255 homozygotes (variable arrest as larva or adult; animals become refractile). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC559 C. elegans mpz-1(gk273)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C52A11.4a. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP gk273 homozygotes (probable embryonic arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC612 C. elegans scpl-1(gk283) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0379.4a. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk283 homozygotes (slow-growing with small broods, dark-bodied, sometimes sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC657 C. elegans gar-3(gk305) V. Show Description
Y40H4A.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC670 C. elegans gar-3(gk337) V. Show Description
Y40H4A.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC721 C. elegans +/szT1 [lon-2(e678)] I; pdi-2(gk313)/szT1 X. Show Description
C07A12.4a. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk313 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC752 C. elegans coq-2(ok1066) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F57B9.4a. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1066 homozygotes (viable lethargic Unc, various body morphology defects, often grotty, does not starve plate easily). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC767 C. elegans set-18(gk334) I. Show Description
T22A3.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC858 C. elegans +/szT1 [lon-2(e678)] I; pdi-2(gk375)/szT1 X. Show Description
C07A12.4a. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk375 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC889 C. elegans wwp-1(gk372) I. Show Description
Y65B4BR.4a. gk372 is a 1509 bp deletion with a 146 bp insertion. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC957 C. elegans wwp-1(gk411) I. Show Description
Y65B4BR.4a. gk411 is a 1455 bp deletion with a 532 bp insertion. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
YEW1 Oscheius carolinensis Oscheius carolinensis. Show Description
Isolated in July 2008 in Raliegh, NC in vermicompost by Yasmin Cardoza. Isolated from Galleria mellonella (great wax moth). It can be maintained at 20C. Called Ral4a.