More Fields
Strain Species Genotype
JK6593 C. elegans fbf-2(q1262[*q945]) II. Show Description
3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions.
JK6596 C. elegans fbf-1(ok91) fbf-2(q1272[*q1023])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6658 C. elegans fbf-1(ok91) fbf-2(q1285[*q1261])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (N415A Y416A Q419A S453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6737 C. elegans fbf-2(q1295[*q1011]) II. Show Description
3xFlag tag inserted into endogenous fbf-2 locus with engineered (S453A H454A E457A Y479A) substitutions.
LP893 C. elegans unc-94a(cp437[mNG-C1::unc-94a]) I. Show Description
mNG reporter inserted into endogenous unc-94 locus, specifically tagging the UNC-94A isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102.
MT7677 C. elegans nIs31. Show Description
nIs31 [mec-7::ced-4a + rol-6(su1006)]. Rollers.
NWG316 C. elegans pkc-3(crk77[I331A,T394A]) II; par-2(it328[gfp::par-2]) III. Show Description
GFP tag inserted into endgonenous par-2 locus in an analogue-sensitive background. pkc-3(crk77[I331A,T394A]) is a CRISPR-engineered analog-sensitive allele containing both I331A (gatekeeper site) and T394A (suppressor site) mutations, allowing rapid and reversible chemical inhibition of PKC-3 activity. Reference: Ng K, et al. (2022). An analog sensitive allele permits rapid and reversible chemical inhibition of PKC-3 activity in C. elegans. Reference: Ng K, et al. microPublication Biology. 10.17912/micropub.biology.000610
OH10260 C. elegans pha-1(e2123) III; otIs356 V; otEx4553. Show Description
otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. otEx4553 [unc-64A(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for otEx5924. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH1421 C. elegans hst-6(ok273) X. Show Description
Phenotypically WT. In hst-6(ok273) , 1064 nt are deleted following position 39378 in Y34B4A (ACC# AC024755) and replaced by four nucleotides CTTT.
PS9030 C. elegans syIs742; syIs300. Show Description
syIs742 [Y41C4A.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
RA334 C. elegans unc-119(ed3) III; him-5(e1490) V; rdIs26. Show Description
rdIs26 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.
RA335 C. elegans unc-119(ed3) III; him-5(e1490) V; rdIs27. Show Description
rdIs27 [R08E3.4::GFP + unc-119(+)]. Construct contains ~5 kb upstream of R08E3.4A. Superficially wild-type. Reference: Large and Mathies (2010) Dev Biol 339(1):51-64.
RB1012 C. elegans egl-8(ok934) V. Show Description
B0348.4a Homozygous. Outer Left Sequence: ACATCCGGAGCTAAAGCAGA. Outer Right Sequence: CGCCGAGAAAGCAATAGAAC. Inner Left Sequence: TGCTACCTATTGGGTTTCGG. Inner Right Sequence: TGGCCGAGTTTTCTCATCTC. Inner Primer PCR Length: 2928. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1145 C. elegans ags-3(ok1169) X. Show Description
F32A6.4a Homozygous. Outer Left Sequence: ctccggttttaaatttggca. Outer Right Sequence: acgttgggttttgagcattc. Inner Left Sequence: ttcgcgatgctcaatatcag. Inner Right Sequence: caaagacgttttgcgactca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1178 C. elegans wwp-1(ok1102) I. Show Description
Y65B4BR.4a. Homozygous. Outer Left Sequence: AACGAAGAAGCGCAGGAGTA. Outer Right Sequence: CAATCGTCCACATCAACGTC. Inner Left Sequence: AGTTCAGAGGCATCCACGTC. Inner Right Sequence: ATCTCTGTACCGCCCTCCTT. Inner Primer PCR Length: 3219 bp. Deletion Size: 1042 bp. Deletion left flank: GCGGAGACCGGCGACAGCGAAGCGTGACAC. Deletion right flank: ACTCAGCCATTGCCACAGGGATGGGAAATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1208 C. elegans mrt-2(ok1260) III. Show Description
Y41C4A.14 Homozygous. Outer Left Sequence: tcacgcaatcagtgagcttc. Outer Right Sequence: accgagcattttattcgacg. Inner Left Sequence: gtgcgatggcctacaaaact. Inner Right Sequence: ctcggggatcgaacattaaa. Inner Primer PCR Length: 3107. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1875 C. elegans Y65B4A.3(ok2425) I. Show Description
Y65B4A.3. Homozygous. Outer Left Sequence: ACCTCCTCAGACGACTCGAA. Outer Right Sequence: GAGCGCGAAAATTCAAAGAG. Inner Left Sequence: GTCGCCATATCGTCGTTTTT. Inner Right Sequence: CCGATTTTAGAGGAAGACCAGA. Inner Primer PCR Length: 3213 bp. Deletion Size: 1830 bp. Deletion left flank: CATGGTTTCCGACTGTTTTTCCTGTTAAAT. Deletion right flank: TTTTTTCCACATGTGTGGATCTCAATTTAT. Insertion Sequence: GTTAAAAAATGTATGAAAAAAAATTTTAAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2263 C. elegans Y23B4A.2(ok3065) X. Show Description
Y23B4A.2. Homozygous. Outer Left Sequence: TCGGCATTCTGTTAGGAAGC. Outer Right Sequence: ACGGAACAGATCTCCTCGAA. Inner Left Sequence: GACCGTAATCCCGTTCACAA. Inner Right Sequence: TGTATTTTGGTAACGCGTCG. Inner Primer PCR Length: 1292 bp. Deletion Size: 598 bp. Deletion left flank: TTCCTTTTCTGTCTTTTATTAATTTCCTTT. Deletion right flank: AAAATTTTGTTTTTCAGTAACAATTCCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2363 C. elegans Y51H4A.13(ok3209) IV. Show Description
Y51H4A.13 Homozygous. Outer Left Sequence: aagccagtagatgtcgggtg. Outer Right Sequence: gccagaaccctgtgaatgat. Inner Left Sequence: tacagcgtccgacatctcac. Inner Right Sequence: tcgaattttcgacaaatcaataa. Inner Primer PCR Length: 1264. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2384 C. elegans Y34B4A.8(ok3242) X. Show Description
Y34B4A.8 Homozygous. Outer Left Sequence: ttatgggggatgaagctttg. Outer Right Sequence: tggagtaccccttgatgagc. Inner Left Sequence: aaatttcagtcatttggccg. Inner Right Sequence: cgattcaaaaagaaagaatatccg. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2523 C. elegans Y34B4A.4(ok3499) X. Show Description
Y34B4A.4 Homozygous. Outer Left Sequence: ggtcttgccacgatttcagt. Outer Right Sequence: taaaaaccgctcaacctcca. Inner Left Sequence: agctgctgttcttgaagctg. Inner Right Sequence: gctcacattgcatcgtgtaaa. Inner Primer PCR Length: 1120. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2527 C. elegans Y39E4A.2(ok3503) III. Show Description
Y39E4A.2 Homozygous. Outer Left Sequence: cccgccaaaaattattcaga. Outer Right Sequence: accgtaatgggacagacagc. Inner Left Sequence: atttccggccaaaaattgat. Inner Right Sequence: tcagaattcagtgttaccgca. Inner Primer PCR Length: 1229. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB525 C. elegans pgl-3(ok257) V. Show Description
C18G1.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB776 C. elegans kin-32(ok166) I. Show Description
C30F8.4a. Homozygous. Outer Left Sequence: gacaagtttgttctgtcccat. Outer Right Sequence: cgtcatgttcctatatgctca. Inner Left Sequence: tgtctgtcacgagcataaatc. Inner Right Sequence: ttcttggaatacggtccttgt. Inner primer WT PCR product: 3500. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB796 C. elegans sta-1(ok587) IV. Show Description
Y51H4A.17. Homozygous. Outer Left Sequence: AATTTCCAGACATGATGGGC. Outer Right Sequence: GCAATACGACTTGCCAGTGA. Inner Left Sequence: GCAGCCACACTTTATGAGCA. Inner Right Sequence: AAAGGTGCCAAATGAAATGG. Inner primer WT PCR product: 2902. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB912 C. elegans ddx-19(ok783) II. Show Description
T07D4.4a. Homozygous. Outer Left Sequence: CCAGTAATGCTCCACCACCT. Outer Right Sequence: CGTGTGACAGAAAATGACGG. Inner Left Sequence: GGAGTTTTAGCCCCGAGAAC. Inner Right Sequence: CGACAGCGAGTCCACTGTAA. Inner Primer WT PCR product: 3113. Deletion size: 1107 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3187 C. elegans Y41D4A.6(ve687[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 Show Description
Homozygous sterile. Deletion of 4404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve687 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ATTTCGGCGCTGTTCCAGACGCTGTCGGCG ; Right flanking sequence: aggcactgtgcgcagttttggttcccgcaa. sgRNA #1: TGACAATCAAATCGACTTCC; sgRNA #2: caattttctagaatttccca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RSL10 C. elegans unc-94(ftw3[GFP::unc-94]) I; myo-3(ftw6[myo-3(head)::SL2::mCherry::myo-3(tail)]) V. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL11 C. elegans unc-94(ftw3[GFP::unc-94]) I. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Outcrossed parental strain RSL3 with N2. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL49 C. elegans unc-94(ftw3[GFP::unc-94]) I; tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous tni-3 locus; GFP::NLS coexpressed from the endogenous tni-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL51 C. elegans unc-94(ftw3[GFP::unc-94]) I; myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. mCherry tag inserted into endogenous myo-3 locus; GFP::NLS coexpressed from the endogenous myo-3 promoter via SL2 trans-splicing. GFP::UNC-94 is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. GFP::UNC-94 is not visible on fluorescent dissection microscopes. Please contact Ryan Littlefield prior to publishing work using this strain.
RW11448 C. elegans unc-119(tm4063) III; stIs11448. Show Description
stIs11448 [nhr-34a::H1-wCherry + unc-119(+)].
RW11703 C. elegans unc-119(tm4063) III; stIs11703. Show Description
stIs11703 [R08E3.4a::H1-wCherry + unc-119(+)].
RW11784 C. elegans unc-119(tm4063) III; stIs11784. Show Description
stIs11784 [C27D6.4a.1::H1-wCherry + unc-119(+)].
SP346 C. elegans 4n (tetraploid). Show Description
TETRAPLOID 4A:4X PICK LARGE TO MAINTAIN
TG4298 C. elegans lem-3(gt3310[eGFP::STag::lem-3[S192A S194A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in putative phosphorylation sites [S192 S194]. Homozygous viable, though [S192A S194A] mutants exhibit increased embryonic lethality after irradiation. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
UTR43 C. elegans par-4(nar12[par-4Ap::mNG + loxP sqt-1(gf) Hygromycin(+) loxP 3X FLAG]) V. Show Description
Homozygous viable, Rol. nar12 (non-excised strain) is null for par-4A & C, but not for par-4B, and is viable. Low rate of spontaneous excision even when maintained at 15C. Pick Rollers to maintain. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
UTR45 C. elegans par-4(nar13[mNG::3X FLAG::par-4a + loxP]) V. Show Description
Superficially wild-type. nar13 was derived by excision of UTR43(nar12) cassette by heat shock. Tagged endogenous PAR-4A & C: weak, ubiquitous fluorescence. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
VC1318 C. elegans Y65B4A.2(ok1809) I. Show Description
Y65B4A.2. Superficially wild type. External left primer: TGATGACTTCCACACGGTTC. External right primer: CGTTCAGCTTCTCGGTTTTC. Internal left primer: TTCGACAAAACATGGTGCAT. Internal right primer: TACTCGTTCCTTTCCATCGG. Internal WT amplicon: 3406 bp. Deletion size: 1338 bp. Deletion left flank: TATCGATTTTTTCCGATAATTATCGATTTT. Deletion right flank: TCCGATAATAATCGACTTTTCCGATAGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1699 C. elegans Y51H4A.18(gk809) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 265 bp. Deletion left flank: CCAAGGCAGATTTGTGAATGAACTCGGCGA. Deletion right flank: ATTAAAAATGTTTACTTTACTTATTTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1704 C. elegans set-26&tsr-25(ok2136) IV/nT1 [qIs51] (IV;V). Show Description
Y51H4A.12 & Y51H4A.15. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2136 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCCATTCCACCAATTCCA. External right primer: TTGAAAAATCGGCTTTCAGG. Internal left primer: ACTCCACTTGATTTCCACCG. Internal right primer: AAATTCCTCGCTTTTCGTCA. Internal WT amplicon: 2473 bp. Deletion size: 1621 bp. Deletion left flank: CTTCTGTCGGGAGAATGATTCGGTCCGCGG. Deletion right flank: CAAATATCCTGTATCACGATTTCGACCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1761 C. elegans Y51H4A.18(gk850) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 435 bp. Deletion left flank: CTTAAAGTATACGTCGATTCTGAAAATACACTGAAAATGAAAT. Deletion right flank: TACAGGTTGGTACTTCTACTATGAAAAAAT. Insertion Sequence: TTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1803 C. elegans Y51H4A.18(gk868) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 472 bp. Deletion left flank: AGTCATTGCACAGCTGGAACAGCAACAGAGACTAGAAAAT. Deletion right flank: ATGATTTTTTCTTGGCTTAAACGATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1830 C. elegans rho-1(ok2418) IV/nT1 [qIs51] (IV;V). Show Description
Y51H4A.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2418 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGGAGAGGAGATGTGTGAT. External right primer: GCAAATCCAGGTTTTTCCCT. Internal left primer: ATTGGAATAGAGAAGCGCGA. Internal right primer: TTTTCACCCGAAAATCCAGA. Internal WT amplicon: 3317 bp. Deletion size: 2091 bp. Deletion left flank: ATTTGGGGGAAAATTAGATGAACTTTTGTT. Deletion right flank: AAAAAACTTAAATTTTCAGCAAAAATTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2476 C. elegans Y43D4A.6(gk1142) IV. Show Description
Y43D4A.6. Identified by PCR, validated by CGH. External left primer: ACGATAAACCAGCAGACGCT. External right primer: TTTGAAAACGGTGTGAAACG. Internal left primer: AACTGTGTTCGAAACCCTCG. Internal right primer: TCAAGCTCATTCGGATTTCA. Internal WT amplicon: 2337 bp. Deletion size: 1390 bp. Deletion left flank: CAAGTTTATCAACAACGTGAAACAGACAAT. Deletion right flank: CAGCAAAAAAATCACTTGCTCCAGTAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2527 C. elegans +/mT1 II; Y39E4A.3(ok2650)/mT1 [dpy-10(e128)] III. Show Description
Y39E4A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2650 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTGGAGCGTAATTTTTCA. External right primer: CGACATTTTGCGGACTTTTT. Internal left primer: GGCACGGTTTTCCTCTTTTT. Internal right primer: GTGGCTGGTGATTTTTCCAC. Internal WT amplicon: 1226 bp. Deletion size: 520 bp. Deletion left flank: TTTCTCCAGAAATATCGATTTTTTAAAAGC. Deletion right flank: CGGAAAGCGTCTCCTTCAACGGTAGAAGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3023 C. elegans srx-4(ok3715) V. Show Description
Y49C4A.5. External left primer: TTTGCCAAACTGACGTCTTG. External right primer: AATTCTCCAGGTGGTCATGG. Internal left primer: AAGGATGGTTCAGGCTTCAT. Internal right primer: CGCAAGCGCTACAGTAGTCA. Internal WT amplicon: 1157 bp. Deletion size: 582 bp. Deletion left flank: TGAATCCCAAATAAATTATTGCATTGGAAG. Deletion right flank: CAAAAAACTCACCATAACGTAGAAAAACGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3127 C. elegans Y41D4A.5(gk3186) IV. Show Description
This strain is homozygous for a deletion (gk3186) in Y41D4A.5, detectable by PCR using the following primers. External left primer: TTTTTATCAGGTGGAAAATGGG. External right primer: GTTATTCGTGTGTTGCCTTGAA. Internal left primer: CGGAGAAAAATTGTGTGGAAA. Internal right primer: TTTCTTCATTTCTCAGCCGAA. Internal WT amplicon: 784 bp. Deletion size: 232 bp. Deletion left flank: AATTCGTGTTTTTTAGCCTAAATTTTCGCT. Deletion right flank: TCAAGTTTTTCAGTGAAAAATTTGAAAAAA. Validation: gk3186 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4259 C. elegans Y51H4A.23(gk5343[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 812 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAATTAATACAACCGCAAAAGTTTGGG; Right flanking sequence: CGAGGAATAAAGATTTGAAAATTGATTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4333 C. elegans eif-4A3(gk5416[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Y65B4A.6. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 638 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAACCAGTCCACCTTTCTACGTGTATTACA. Right flanking sequence: CGGGGATGGCGCGTTGCTGGATGGCAGATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.