More Fields
Strain Species Genotype
RB1589 C. elegans mls-1&H14A12.6(ok1948) III. Show Description
H14A12.4, H14A12.6. Homozygous. Outer Left Sequence: ATCATCGCTGGTCTTGATCC. Outer Right Sequence: GAGTCTTTCGTTGCGAGACC. Inner Left Sequence: TCATTGAAAAGGAACCCTCG. Inner Right Sequence: TTTACCCTTCCCGTTGACAC. Inner Primer PCR Length: 2285 bp. Deletion Size: 1183 bp. Deletion left flank: ATAGTTGAAACATTTTTGACTGTAATTAAA. Deletion right flank: TGAATCGTGACTTTTCCGACAAACCGGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1680 C. elegans C24A8.1(ok2090) X. Show Description
C24A8.1. Homozygous. Outer Left Sequence: GATGAACGAATCGGAAATCG. Outer Right Sequence: TGTGAGTTTTGCGGACAAAG. Inner Left Sequence: CAGCCTGAATGGGCATATCT. Inner Right Sequence: AGTGGAGTTGCATGACCAAA. Inner Primer PCR Length: 3261 bp. Deletion Size: 1027 bp. Deletion left flank: TTGCACTGAAAATTTCAATTATAGTACTGT. Deletion right flank: ATTTTTCAGCAAGTTAGAAAGCAAAAGTAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1837 C. elegans C54A12.2(ok2376) II. Show Description
C54A12.2. Homozygous. Outer Left Sequence: AGGCTACCGTGTCGGTATTG. Outer Right Sequence: TCAGTCGGCAACGTATGAAA. Inner Left Sequence: GAAAAATGTTGAGGCGGTGT. Inner Right Sequence: ATCTTTGGCATGTTTGGCTC. Inner Primer PCR Length: 2721 bp. Deletion Size: 1540 bp. Deletion left flank: TCCCACTTCCTTCTGCAATAACCTTAACAC. Deletion right flank: CAGAGAATGCAATTTGATAATGATGGTTCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1877 C. elegans Y44A6D.3(ok2427) V. Show Description
Y44A6D.3. Homozygous. Outer Left Sequence: AGGTGTTCCACCAGCACAAT. Outer Right Sequence: TGCCGTGCTTCTATCTTCCT. Inner Left Sequence: TCTCTCATCTTTCGCTTCACC. Inner Right Sequence: CAACTCTTAAGCCACAAAACTGT. Inner Primer PCR Length: 3141 bp. Deletion Size: 1471 bp. Deletion left flank: ATTCTGATGGAAATGACTAGAAGGCAAGGC. Deletion right flank: ATTGATGTGCCTGAAATTTGAAAAAAATGT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1973 C. elegans W04A4.4(ok2601) I. Show Description
W04A4.4. Homozygous. Outer Left Sequence: AAGTAACATGCTCATCCCCG. Outer Right Sequence: TTGAATGCATGAGTTGCTCC. Inner Left Sequence: TTTGTTCCCCTATTCGCATC. Inner Right Sequence: GCCAAAAGGCTATCCTATGATCT. Inner Primer PCR Length: 3177 bp. Deletion Size: 1678 bp. Deletion left flank: GTAGAAAAAAATACCGTTTTTTGTTTGAAG. Deletion right flank: CCCAAATTGCTCTTGTTGATCCTTACAGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2234 C. elegans E04A4.6(ok3021) IV. Show Description
E04A4.6. Homozygous. Outer Left Sequence: GAGACATGCGTCAGCAAAGA. Outer Right Sequence: GCAATTTCAGCATCCGATTT. Inner Left Sequence: GCTTGCGTCCTTCTTGACTT. Inner Right Sequence: TGGAACTCAAAATGTGATAACGA. Inner Primer PCR Length: 1379 bp. Deletion Size: 515 bp. Deletion left flank: AAGGAAGAACACAGGAGATGGTGCAATAGA. Deletion right flank: CTGTCATATTCCTTTTCGTTATCACATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2342 C. elegans adm-2(ok3178) X. Show Description
C04A11.4. Homozygous. Outer Left Sequence: GGGAGATCAAATTTCGGTGA. Outer Right Sequence: CGATTGGCGGAAATTCTAAA. Inner Left Sequence: TCCAGATTCAAAAGAGACGTTG. Inner Right Sequence: CCACTGAGCGTAGTCCACCT. Inner Primer PCR Length: 1253 bp. Deletion Size: 989 bp. Deletion left flank: CTTGATGACGTGGGTGTTCCTATACAAAAA. Deletion right flank: TTTGTATAAAAATAGAGAAAAATATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2391 C. elegans grl-29(ok3261) V. Show Description
T24A6.18 Homozygous. Outer Left Sequence: aaggtctattcactggcgga. Outer Right Sequence: ccggccaattctaaacaaag. Inner Left Sequence: gaattgaattaggcaacgacaa. Inner Right Sequence: tgctcaataatcggaaacca. Inner Primer PCR Length: 1189. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2419 C. elegans Y44A6D.3(ok3314) V. Show Description
Y44A6D.3 Homozygous. Outer Left Sequence: tggacaacccgtagacacaa. Outer Right Sequence: gaaatgcatggttacggctc. Inner Left Sequence: aggtgttccaccagcacaat. Inner Right Sequence: gtcggttttcaaaatttccg. Inner Primer PCR Length: 1323. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2504 C. elegans F54A5.1(ok3467) I. Show Description
F54A5.1 Homozygous. Outer Left Sequence: atccgatcagttgctcaagg. Outer Right Sequence: gattagcagtcgatgacgca. Inner Left Sequence: tttcggcgagctggaagt. Inner Right Sequence: gaaacgacttgagggctgac. Inner Primer PCR Length: 1127. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB579 C. elegans ife-2(ok306) X. Show Description
R04A9.4. Homozygous. Outer Left Sequence: AAACATTCGTTCATTTCCGC. Outer Right Sequence: GCACAGCAGCGATGTAAAAA. Inner Left Sequence: ATTTAAGTGGCTGGTGTGGC. Inner Right Sequence: CGTTTTGCCAATCGAATTTT. Inner primer WT PCR product: 2315. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB659 C. elegans C54A12.4(ok400) II. Show Description
C54A12.4. Homozygous. Outer Left Sequence: tcatccttcggcataccttc. Outer Right Sequence: atttcccactggttgcactc. Inner Left Sequence: tccgtggtggttattggatt. Inner Right Sequence: gaaaccggtcacaagttcgt. Inner primer WT PCR product: 2628. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB839 C. elegans F54A3.4(ok666) II. Show Description
F54A3.4. Homozygous. Outer Left Sequence: ATAGAAAATGCGAGAGCGGA. Outer Right Sequence: GCCTGCCTACCATTAAAGCA. Inner Left Sequence: TGTGCAGGGTGTCTCATTGT. Inner Right Sequence: TTGAAATTTCTCGGGGTACG. Inner primer WT PCR product: 2859. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW11433 C. elegans unc-119(tm4063) III; stIs11433. Show Description
stIs11433 [R04A9.5::H1-wCherry + unc-119(+)].
RW11475 C. elegans unc-119(tm4063) III; stIs11475. Show Description
stIs11475 [R04A9.5::H1-wCherry + unc-119(+)].
UL6 C. elegans leIs6. Show Description
leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.
VC1018 C. elegans +/szT1 [lon-2(e678)] I; gck-4(ok1352)/szT1 X. Show Description
C04A11.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1352 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1217 C. elegans egl-27(ok1670) II. Show Description
C04A2.3. External left primer: TCGAGTTGGGCTCAGTCTTT. External right primer: CAGCGATGATGATGAAGGAA. Internal left primer: GGTAAAAGCTGCCAATCCAA. Internal right primer: CTTGTCCTCACTCCGCTCTC. Internal WT amplicon: 2523 bp. Deletion size: 1747 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1497 C. elegans fum-1(ok1998) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1619 C. elegans +/szT1 [lon-2(e678)] I; sex-1(ok2071)/szT1 X. Show Description
F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2071 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGACTGGACCTACAGAGGG. External right primer: GGCAGCAACATCTACAGCAA. Internal left primer: TGTGTTGGAATGAAAACGGA. Internal right primer: AGGGACCAGATCAGTTGTGC. Internal WT amplicon: 3077 bp. Deletion size: 2408 bp. Deletion left flank: TACTAAGTCGATTCAATTCATGAATACATT. Deletion right flank: CACAGTCTTTTTACCACGCCTACATCGCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1688 C. elegans sex-1(gk808) X. Show Description
F44A6.2. External left primer: ACCATTCATGCCTACCTTGC. External right primer: GTCATCGCTTCCCAACATCT. Internal left primer: ATCCACTTGCTTTGTCTCCG. Internal right primer: TGGTGAAGTGAGCTCGAGTG. Internal WT amplicon: 2458 bp. Deletion size: 630 bp. Deletion left flank: AACTCAACTTGGCAGATTACAGATTTAACA. Deletion right flank: TCTTAGGTGAGGAAAAAAATCTGTGTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1703 C. elegans +/szT1 [lon-2(e678)] I; sex-1(gk829)/szT1 X. Show Description
F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk829 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACCATTCATGCCTACCTTGC. External right primer: GTCATCGCTTCCCAACATCT. Internal left primer: ATCCACTTGCTTTGTCTCCG. Internal right primer: TGGTGAAGTGAGCTCGAGTG. Internal WT amplicon: 2458 bp. Deletion size: 725 bp. Deletion left flank: AGAAATAGACTCCCTAACTTACCACTTGTT. Deletion right flank: CGTGTATTAATCTGCGCTGAATGCCTGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1715 C. elegans crn-3(ok2269) II. Show Description
C14A4.4. External left primer: TTCCAGATGTCGGTTCATCA. External right primer: GGTTTTTGTTCGTTTTTCGC. Internal left primer: GCTCAGGACAACATTGCAGA. Internal right primer: TTCAAACTTTTGTTGCTGCG. Internal WT amplicon: 2914 bp. Deletion size: 1049 bp. Deletion left flank: GGGATTGTCGGCGAAAGAAAGAAATGATGC. Deletion right flank: TGCTCGACGAAATATAGATGTTTCTGTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1765 C. elegans rpl-20(ok2256) IV/nT1 [qIs51] (IV;V). Show Description
E04A4.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2256 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCGTAATTTGTTCGCGTT. External right primer: GATTGCTGATAACCCGTCGT. Internal left primer: GTTCCGATTTCTTGGTGCAT. Internal right primer: GAAACATGTGCAAGAGCCATT. Internal WT amplicon: 2463 bp. Deletion size: 1213 bp. Deletion left flank: TAAGAATTAATTTACCTTATCGAAATAGTG. Deletion right flank: TTCTATTACCGTATCCTTCATACACTCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1818 C. elegans T04A8.3&tag-243(ok1855) III. Show Description
T04A8.4, T04A8.3. Superficially wild type. External left primer: CCTTGAACACCCTTCGAAAA. External right primer: TCTGGGAGTCGTTCCAAAAC. Internal left primer: AGCGGATTCCAAAATCATCA. Internal right primer: GTCAGCTGGTCTCGTTGTGA. Internal WT amplicon: 2106 bp. Deletion size: 1416 bp. Deletion left flank: TCTGTACCTTGTATCCATTTCTGGCACGAT. Deletion right flank: GCCTGAAAATTCAGTTAATTTAGACTTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1853 C. elegans dre-1(gk857) V/nT1 [qIs51] (IV;V). Show Description
K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk857 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCATTTGTTGAGCCTGCTG. External right primer: ACGCTGAGAGTAAGTGCGGT. Internal left primer: TCAGTGAATGTCAATGCGGT. Internal right primer: CCCGATCATTCTCAACCATT. Internal WT amplicon: 2234 bp. Deletion size: 1021 bp. Deletion left flank: TGAAAACACTTTGAGAAGAAGTTCTTCGGG. Deletion right flank: TAGATGGTGGCAGATTCCGAATAGCTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1867 C. elegans T24A6(gk1030) V. Show Description
T24A6. External left primer: AGGAGGAACTCCTCATCGGT. External right primer: CTGTCCTCGCACAAAATCAA. Internal left primer: GGAGTGGTCAAACGGTCATT. Internal right primer: TTCCAGGCTACCCAAATAGC. Internal WT amplicon: 2157 bp. Deletion size: 185 bp. Deletion left flank: ATAAAACTAAACTTTTGTGTAAATAATACA. Deletion right flank: AATTGGGATATGTTAATGGTGGCGCTACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC193 C. elegans him-6(ok412) IV. Show Description
T04A11.6. Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1971 C. elegans flp-24(gk3109) III. Show Description
This strain is homozygous for a deletion (gk3109) in C24A1.1, detectable by PCR using the following primers. External left primer: AGACCACGCCTACTACTTGGC. External right primer: CCATGTTGCTTCCAGTGCCAC. Internal left primer: CGATGTTCCGCTCTGAGCTTC. Internal right primer: TGGTCACAGTGCATTGCTCTC. Internal WT amplicon: 2029 bp. Deletion size: 1180 bp. Deletion left flank: TTTCGAAAGCTTGCCGCAAAACTCTGCCAT. Deletion right flank: AGACCTAAAAATTCCGGCAAATACCACATT. Validation: gk3109 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC206 C. elegans fzy-1&cyp-44A1(ok312) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2280 C. elegans dre-1(ok2905) V/nT1 [qIs51] (IV;V). Show Description
K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2905 homozygotes (early larval arrest; escapers may lay eggs that hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGTAGGGATTCGCATGA. External right primer: CCCCTTTCAATTTCGAGTCA. Internal left primer: CAGCCAAAGTATTTCGAGCA. Internal right primer: CAGAAGGTCGAGGGAGACAT. Internal WT amplicon: 1211 bp. Deletion size: 741 bp. Deletion left flank: CTGCTGCCTGCACACTGGATCAGCCCGAAA. Deletion right flank: TTTTTTTCATTATTTCTTATCTCAAAAATG. Insertion Sequence: TCATTTTTTTATCTATCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2301 C. elegans ptr-6(ok2988) II. Show Description
C54A12.1. External left primer: AAAATGATGTTCCTTTGCCG. External right primer: GCTCTTGTGGTTCGGAATGT. Internal left primer: CAAGAGCTGAAATTTTGAATAGGA. Internal right primer: ACACTCATCGCTCCGTTCTT. Internal WT amplicon: 1379 bp. Deletion size: 493 bp. Deletion left flank: TCTCTGAAATGATGGAAATGTAAAAAGGTA. Deletion right flank: CAAAGAAGGTGATTTGATAAAGGAATGTGA. Insertion Sequence: CAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2377 C. elegans C14A4.13(gk1199) II. Show Description
C14A4.13. Identified by PCR, validated by CGH. External left primer: CACCTTTCCCCATGAAAATG. External right primer: GTCGCCAATGAGACGAATTT. Internal left primer: GCAGCAGTAGTGGCAGTGAA. Internal right primer: TTTCCCGAAGAAGAACGATG. Internal WT amplicon: 2574 bp. Deletion size: 1569 bp. Deletion left flank: CGATTCGCTTGCAAAGCTGAGCTCGCAATT. Deletion right flank: TACCAAAGTCCCACCTGCTCATTAGATTGA. Insertion Sequence: TCGGTTTAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC249 C. elegans cyp-14A5(gk152) V. Show Description
F08F3.7. Superficially wild type, mildly Him, some progeny sterile. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2534 C. elegans nhr-281(gk1108) X. Show Description
F16B12.8, C24A1.3. External left primer: GCGTCCACAAAAGTGTCAGA. External right primer: GGTTTGAGAATTGCCGGATA. Internal left primer: CAACACCGTGGCATTTAGTG. Internal right primer: CCTTCACTGCACGCTAAACA. Internal WT amplicon: 1959 bp. Deletion size: 1071 bp. Deletion left flank: ACGAGGCTCAGATTGTTTATGAAATCAAAA. Deletion right flank: AAATAAAATGTGTTCTTTGGAGACAGAATA. Insertion Sequence: TTATAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2598 C. elegans C14A4.13(gk1144) II. Show Description
C14A4.13. Identified by PCR, validated by CGH. External left primer: CACCTTTCCCCATGAAAATG. External right primer: GTCGCCAATGAGACGAATTT. Internal left primer: GCAGCAGTAGTGGCAGTGAA. Internal right primer: TTTCCCGAAGAAGAACGATG. Internal WT amplicon: 2574 bp. Deletion size: 945 bp. Deletion left flank: ATGTTTGTAAGTTGAATCTTATCTAAAGCT. Deletion right flank: GCACCAGTAGCACATTCTCCACGGAAATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3919 C. elegans C24A3.1(gk3852[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2821 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCATTGTTATTCAGACACCTGAAAGACCC; Right flanking sequence: TGGAAAAACAGCTGCATCGTCAGATCAACA. See WormBase Variation gk3852 for details.
VC4475 C. elegans W04A8.6(gk5429[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I. Show Description
Apparent homozygous lethal or sterile deletion balanced by hIn1[unc-101]. Pick viable fertile GFP+ animals to maintain; hIn1 homozygotes are non-GFP Unc. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAAGTCGAATTTTTAGCCAAAAACCTTAG. Right flanking sequence: GCCGCTCAAATTGCGTATAAAAGGACGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4625 C. elegans F44A2.3(gk5695[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 5155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTCTCGGCATTTTTTGGTTTACCGTCT. Right flanking sequence: GTCTCACTTCTTCCAAATGCTCTGCTTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC479 C. elegans coq-1(ok749)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
C24A11.9. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok749 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC506 C. elegans cgef-1(gk261) X. Show Description
C14A11.3a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC522 C. elegans tag-153(ok699) V. Show Description
F44A2.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC582 C. elegans +/mT1 II; pgap-2(gk285)/mT1 [dpy-10(e128)] III. Show Description
T04A8.12. Homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, sterile Dpy-10 mT1 homozygotes, arrested mT1 aneuploids, and gk285 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC603 C. elegans cyp-14A2(gk289) X. Show Description
K09A11.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC774 C. elegans dohh-1&dap-3(gk347)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C14A4.1, C14A4.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT relatively dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk347 homozygotes (L4 to young adult arrest, often bursts at gonadal placque or vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC793 C. elegans tag-243(gk355) III. Show Description
T04A8.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC857 C. elegans +/szT1 [lon-2(e678)] I; C24A8.6(gk413)/szT1 X. Show Description
C24A8.6. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and gk413 homozygotes (sick, often sterile, with body morphology defects, lots of arrested embryos). Also segregates viable gk413 hemizygotes (WT males). Phenotype of homozygote may be suspicious, as deletion appears to affect only an intron. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC902 C. elegans dohh-1(gk398)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C14A4.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk398 homozygotes (sterile adult with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WM156 C. elegans R04A9.2(tm1116) X. Show Description