YEW1 |
Oscheius carolinensis |
Oscheius carolinensis. Show Description
Isolated in July 2008 in Raliegh, NC in vermicompost by Yasmin Cardoza. Isolated from Galleria mellonella (great wax moth). It can be maintained at 20C. Called Ral4a.
|
|
ZW64 |
C. elegans |
unc-68(r1162) V; zwIs100. Show Description
zwIs100 [rab-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Larger and moves better than unc-68(r1162). Also called ZW64A.
|
|
AA776 |
C. elegans |
cyp-44A1(ok216) II. Show Description
|
|
BC10475 |
C. elegans |
dpy-5(e907) I; sEx10475. Show Description
sEx10475 [rCesC24A11.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10623 |
C. elegans |
dpy-5(e907) I; sEx10623. Show Description
sEx10623 [rCesF54A5.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10723 |
C. elegans |
dpy-5(e907) I; sEx10723. Show Description
sEx10723 [rCes C24A1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10732 |
C. elegans |
dpy-5(e907) I; sIs10623. Show Description
sIs10623[rCesF54A5.3a::GFP + pCeh361]. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10733 |
C. elegans |
dpy-5(e907) I; sEx10623. Show Description
sEx10623[rCesF54A5.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10853 |
C. elegans |
dpy-5(e907) I; sIs10623. Show Description
sIs10623 [rCesF54A5.3A::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10862 |
C. elegans |
dpy-5(e907) I; sEx10862. Show Description
sEx10862 [rCes T04A8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC11911 |
C. elegans |
dpy-5(e907) I; sEx11911. Show Description
sEx11911 [rCes T04A11.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12301 |
C. elegans |
dpy-5(e907) I; sIs10475. Show Description
sIs10475 [rCesC24A11.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12407 |
C. elegans |
dpy-5(e907) I; sEx12407. Show Description
sEx12407 [rCesT04A8.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12408 |
C. elegans |
dpy-5(e907) I; sEx12408. Show Description
sEx12408 [rCes T04A8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12557 |
C. elegans |
dpy-5(e907) I; sEx12557. Show Description
sEx12557 [rCes T04A6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12696 |
C. elegans |
dpy-5(e907) I; sIs12408. Show Description
sIs12408 [rCes T04A8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12997 |
C. elegans |
dpy-5(e907) I; sIs12740 . Show Description
sIs12740 [rCes T04A8.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13306 |
C. elegans |
dpy-5(e907) I; sIs12555. Show Description
sIs12555 [rCes T04A6.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13446 |
C. elegans |
dpy-5(e907) I; sEx13446. Show Description
sEx13446 [rCes Y44A6B.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13643 |
C. elegans |
dpy-5(e907) I; sEx13643. Show Description
sEx13643 [rCes C04A11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13771 |
C. elegans |
dpy-5(e907) I; sEx13771. Show Description
sEx13771[rCesC24A8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13892 |
C. elegans |
dpy-5(e907) I; sEx13892. Show Description
sEx13892[rCesC14A4.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC14409 |
C. elegans |
dpy-5(e907) I; sEx14409. Show Description
sEx14409 [rCes C14A4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC14775 |
C. elegans |
dpy-5(e907) I; sEx14775. Show Description
sEx14775 [rCesY44A6B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC15032 |
C. elegans |
dpy-5(e907) I; sEx15032. Show Description
sEx15032 [rCesC54A12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). drn-1::GFP.
|
|
BC15281 |
C. elegans |
dpy-5(e907) I; sEx15281. Show Description
sEx15281[rCesT24A6.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC15282 |
C. elegans |
dpy-5(e907) I; sEx15282. Show Description
sEx15282[rCesT24A6.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC15310 |
C. elegans |
dpy-5(e907) I; sEx15310. Show Description
sEx15310 [rCes R04A9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC16163 |
C. elegans |
dpy-5(e907) I; sEx16163. Show Description
sEx16163 [rCes T04A8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC4666 |
C. elegans |
sEx82. Show Description
sEx82 [T04A6 (III) + pCes1943[rol-6(su1006)]]. segrgnt 1. 20 ng/ul T04A6 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC5022 |
C. elegans |
sEx190. Show Description
sEx190 [F58A4 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul F54A8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC5523 |
C. elegans |
sEx570. Show Description
sEx570 [C14A1 (X) + pCes1943[rol-6(su1006)]]. 20 ng/ul C14A1 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
CX3596 |
C. elegans |
kyIs128 lin-15B&lin-15A(n765) X. Show Description
kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
CY398 |
C. elegans |
daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
|
|
DM7301 |
C. elegans |
pha-1(e2123) III; raEx301. Show Description
raEx301 [W04A8.4::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7355 |
C. elegans |
pha-1(e2123) III; raEx355. Show Description
raEx355 [F44A2.5::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7365 |
C. elegans |
pha-1(e2123) III; raEx365. Show Description
raEx365 [C24A3.2::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
GR1971 |
C. elegans |
mgEx779. Show Description
mgEx779 [lipl-4p::K04A8.5p::lipl-4::SL2::GFP + myo-2p::mCherry]. Polycistronic translational fusion; GFP and LIPL-4 expressed separately. Pick animals with red pharynx to maintain. Reference: Wang et al. Science. 2008 Nov 7;322(5903):957-60.
|
|
GR2250 |
C. elegans |
mgIs73 V. Show Description
mgIs73 [cyp-14A4p::gfp::cyp-14A4 3UTR + myo-2p::mCherry] V. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
|
|
GR2252 |
C. elegans |
hsp-6(mg585) V; mgIs73 V. Show Description
mgIs73 [cyp-14A4p::GFP::cyp-14A4 3UTR + myo-2p::mCherry] V. Slow growth. Low brood size. Received as a replacement for GR2249. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
|
|
GS3754 |
C. elegans |
sel-13(ok303) III; arIs51 IV; sel-7(n1253) unc-3(e151) X. Show Description
arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
IG122 |
C. elegans |
frP8 frP9 III. Show Description
Mos1 transposon insertion: frP8: H14A12 (at position 9047) acacctggtaTACAATTTTGATTTCAGAAAGTTCTCTGAC, and frP9: Y45F3A (at position 220) acacctggtaGAATTGTTCGAACAAGCTTCAACGAGAAAGCAA. Mos1 sequence is in lowercase.
|
|
KX15 |
C. elegans |
ife-2(ok306) X. Show Description
No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).
|
|
LY140 |
C. elegans |
F44A2.2(nf140) V. Show Description
A 150 bp deletion in F44A2.2 corresponding to base pairs #27451-27600 in the published C. elegans cosmid F44A2 sequence (Genbank accession #U41993). The predicted protein F44A2.2 is called "nshab1", which is homologous to potassium voltage-gated channel subfamily B, member 2.
|
|
NH3119 |
C. elegans |
F54A5.3a(ok198) I. Show Description
No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.
|
|
NK774 |
C. elegans |
unc-119(ed4) III; qyEx116. Show Description
qyEx116 [C14A11.3b::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
NK775 |
C. elegans |
unc-119(ed4) III; qyEx117. Show Description
qyEx117 [C14A11.3a,c::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
OH10993 |
C. elegans |
otEx4944. Show Description
otEx4944 [lin-53::GFP + rol-6(su1006)]. Rollers. Maintain at 25C; pick Rollers. GFP recombineered at C-terminus of lin-53 in fosmid WRM0634aA12. otEx4945 was generated as a complex array with digested bacterial genomic DNA.
|
|
OH2000 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx1076. Show Description
otEx1076 [unc-47p(long)::lin-23cDNA(yk784a08) + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
|
|
OH7159 |
C. elegans |
C24A1.2(tm801) III; vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
|
|