More Fields
Strain Species Genotype
LP538 C. elegans gsk-3(cp251[gsk-3::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP559 C. elegans mom-2(cp267[mom-2::mNG-C1^3xFlag]) V. Show Description
FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP560 C elegans dhc-1(cp268[dhc::mNG-C1::3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP563 C elegans dnc-1(cp271[dnc::mNG-C1::3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP585 C elegans lin-5(cp288[lin-5::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP591 C elegans lis-1(cp294[lis-1::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP598 C elegans dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP600 C elegans klp-4(cp303[klp-4::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP604 C elegans klp-8(cp307[klp-8::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP608 C elegans klp-20(cp311[klp-20::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP697 C. elegans mom-5(cp367[mom-5::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP705 C elegans dsh-1(cp375[dsh-1DIX::mNG-C1^3xFlag::PDZ,DEP]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP713 C elegans pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
MDX44 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
MIR249 C. elegans risIs33. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511.
MIR250 C. elegans hif-1(ia4) V; risIs33. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and ZG31.
MIR251 C. elegans hsf-1(sy441) I; risIs33. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and PS3551.
MIR276 C. elegans risIs33; gpIs1. Show Description
risIs33 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+)]. gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. risIs33 transgene stably expresses a 171 kDa dCas9::VP64 fusion protein suitable for for CRISPR activation (CRISPRa) in C. elegans, as described in Fischer F, et al. J Biol Chem. 2022 May 27;102085. doi: 10.1016/j.jbc.2022.102085. PMID: 35636511. Derived by crossing parental strains MIR249 and TJ375.
MLC1065 C. elegans pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1245 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1726 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1729 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC2465 C. elegans oxIs322 II; unc-119(ed3) III; lucEx1311. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3’UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
NC1700 C. elegans unc-119(ed3) III; wdEx637. Show Description
wdEx637 [dat-1::3xFLAG::pab-1 + unc-119(+)]. Pick non-Unc to maintain. Reference: Spencer WC, et al. Genome Res. 2011 Feb;21(2):325-41.
NC694 C. elegans unc-119(ed1) III; wdEx257. Show Description
wdEx257 [unc-4::3XFLAG::pab-1 + (pSV17) unc-119 minigene]. Animals exhibit slight forward movement defect. Good antibody staining witih anit-FLAG M2 antibody (Sigma). 100% penetrant array. Expressed in all unc-4 neurons. Ectopically expressed in at least one head neuron (dorsal to pharynx, between two bulbs).
NK2225 C. elegans unc-59(qy50[unc-59::GFP::3xflag::AID]) I. Show Description
CRISPR/Cas9-engineered insertion of GFP::3xflag::AID tags into endogenous unc-59/septin locus. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000200/
NK2936 C. elegans unc-6(cp190[unc-6::mNG::3xFLAG + LoxP]) X. Show Description
mNG and 3xFlag tags inserted into the endogenous unc-6 locus. Superficially wild-type. Reference: Naegeli KM, et al. Dev Cell. 2017 Nov 20;43(4):403-417.e10. doi: 10.1016/j.devcel.2017.10.024. PMID: 29161591
OD2906 C. elegans mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2909 C. elegans san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I. Show Description
GFP tag inserted at 5' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac
OD3913 C. elegans cyb-1(lt125[cyb-1::LAP::mNG::loxP::3xFlag]) IV. Show Description
mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4087 C. elegans cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4376 C. elegans mdf-1(lt167[mScarlet::tev::loxP::3xFlag::mdf-1])V. Show Description
CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.
OG472 C. elegans drSi2 II; unc-119(ed3) III. Show Description
drSi2 [vha-6p::3XFLAG::pgp-3/CFTR(wt)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with enrichment at the apical membrane. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR (TIKENIIFG). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG474 C. elegans drSi4 II; unc-119(ed3) III. Show Description
drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OH13908 C. elegans daf-16(ot821[daf-16::mKate2::3xFLAG]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH14125 C. elegans daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
OH14130 C. elegans che-1(ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.
OH14589 C. elegans daf-12(ot870[daf-12::GFP::3xFlag]) X. Show Description
Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14654 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted
OH14888 C. elegans daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
OH14891 C. elegans daf-12(ot874[daf-12::TagRFP::3xFlag::AID]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID conditional daf-12 allele. Reference: Aghayeva et al., submitted
OH14892 C. elegans daf-3(ot875[daf-3::GFP::3xFlag]) X. Show Description
Superficially wildtype. GFP tag inserted into endogenous daf-3 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14896 C. elegans daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID conditional daf-3 allele. Reference: Aghayeva et al., submitted
OH14897 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH14945 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH14946 C. elegans ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
OH15227 C. elegans unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).
OH15439 C. elegans ceh-34(ot903[ceh-34::mNG::3xFLAG::AID]) V. Show Description
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH15568 C. elegans unc-17(ot907[unc-17::mKate2::3xflag]) IV. Show Description
Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
OH15579 C. elegans che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).