GLW95 |
C. elegans |
F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. Show Description
C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd 5 AAATCGTGCTCTCCCAAGCA 3; rev 5 CTTGTCACCTGACGGGATGT 3. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.
|
|
GOU2162 |
C. elegans |
che-3(cas443[gfp::che-3]) I; xbx-1(cas502[xbx-1::tagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
|
|
GOU2187 |
C. elegans |
klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
|
|
GW1262 |
C. elegans |
xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
|
|
GW1539 |
C. elegans |
gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
|
|
GW1623 |
C. elegans |
arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
|
|
HW1822 |
C. elegans |
lin-29(xe61[lin-29::gfp::3xflag]) II Show Description
Low penetrance Pvl (i.e., tagged protein appears not fully functional). CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to LIN-29. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., Mol Cell. 2017 Feb 2;65(3):476-489.
|
|
HW1826 |
C. elegans |
lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )
|
|
HW1835 |
C. elegans |
lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078
|
|
JCP341 |
C.elegans |
jcpSi10 II; unc-119(ed3) III. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
JCP378 |
C. elegans |
jcpSi19 II; unc-119(ed3) III. Show Description
jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
JCP383 |
C. elegans |
jcpSi10 II; ints-6(tm1615) IV. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
JCP387 |
C. elegans |
jcpSi24 II; unc-119(ed3) III. Show Description
jcpSi24 [H27M09.5p::H27M09.5::3xFLAG::eGFP::H27M09.5 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
JCP394 |
C. elegans |
jcpSi31 II; unc-119(ed3) III. Show Description
jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
JCP405 |
C. elegans |
jcpSi37 II; unc-119(ed3) III. Show Description
jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
JCP462 |
C. elegans |
ints-6(jcp1[ints-6::3xFLAG]) IV. Show Description
3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
|
|
JCP519 |
C. elegans |
nxf-1(t2160) V; jcpEx6. Show Description
jcpEx6 [nxf-1p::nxf-1::3xFLAG::eGFP::nxf-1UTR]. jcpEx6 transgene rescues nxf-1(t2160) embryonic lethality at 25C. Temperature-sensitive; maintain at 25C to retain the array. nxf-1(t2160) mutants are 100% embryonic lethal at 25C. Reference: Zheleva A, et al. PLoS Genet. 2019 Sep 16;15(9):e1008338.
|
|
JH2932 |
C. elegans |
unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
|
|
JH3186 |
C. elegans |
gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3188 |
C. elegans |
mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3193 |
C. elegans |
nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH4008 |
C. elegans |
htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
|
|
JIM173 |
C. elegans |
unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
|
|
JIM193 |
C. elegans |
ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
|
|
JIM220 |
C. elegans |
ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
|
|
JIM356 |
C. elegans |
ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
|
|
JJ2286 |
C. elegans |
unc-119(ed3) III; zuIs263. Show Description
zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
|
|
JJ2300 |
C. elegans |
unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
|
|
JJ2586 |
C. elegans |
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Show Description
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.
|
|
JK4871 |
C. elegans |
fog-3(q520) I; qSi41 II. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
|
|
JK4942 |
C. elegans |
sygl-1(tm5040) I; qSi49 II; unc-119(ed3) III. Show Description
qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
|
|
JK4996 |
C. elegans |
lst-1(ok814) I; qSi69 II; unc-119(ed3) III Show Description
qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
|
|
JK5028 |
C. elegans |
qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
|
|
JK5200 |
C. elegans |
fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
|
|
JK5896 |
C. elegans |
qSi369 II; unc-119(ed3) III; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
|
|
JK5932 |
C. elegans |
sygl-1(q828) I; qSi369 II; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
|
|
JK5943 |
C. elegans |
qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
|
|
JMC101 |
C. elegans |
csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
|
|
JMC135 |
C. elegans |
vsra-1(tor94[GFP::3xFLAG::vsra-1] I. Show Description
GFP and 3xFLAG tags inserted into endgonenous vsra-1/C04F12.1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
JMC151 |
C. elegans |
csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
|
|
JMC164 |
C. elegans |
csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
|
|
JMC201 |
C. elegans |
alg-1(tor137[GFP::3xFLAG::alg-1b]) X. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-1 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
JMC203 |
C. elegans |
alg-2(tor139[GFP::3xFLAG::alg-2b]) II. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-2 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
JMC205 |
C. elegans |
alg-3(tor141[GFP::3xFLAG::alg-3]) IV. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-3 locus. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
|
|
JMC207 |
C. elegans |
alg-4(tor143[GFP::3xFLAG::alg-4]) III. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-4 locus. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
|
|
JMC209 |
C. elegans |
alg-5(tor145[GFP::3xFLAG::alg-5]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-5 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
JMC211 |
C. elegans |
ergo-1(tor147[GFP::3xFLAG::ergo-1a]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous ergo-1 locus; specifically tags a-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
JMC213 |
C. elegans |
prg-1(tor149[GFP::3xFLAG::prg-1]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous prg-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
JMC217 |
C. elegans |
rde-1(tor153[GFP::3xFLAG::rde-1]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous rde-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
JMC219 |
C. elegans |
wago-1(tor113[GFP::3xFLAG::wago-1]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous wago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|