More Fields
Strain Species Genotype
DV3402 C. elegans ral-1(re218[mKate2::3xFlag::ral-1]) III. Show Description
Ubiquitous expression and localization to plasma membranes. Derived in an N2 background. TD185 5’ -GCCGGAAGAGTGATGAACCC- 3’ TD186 5’ -TAATGAGCTCGGAGACCATGGC- 3’ TD187 5’ -CGCACCTCATCATACATGAACTGC- 3’ Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3670 C. elegans rheb-1(re64 re285[AID::mKate2::3xFlag::rheb-1]) III. Show Description
AID tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous red expression.
DZ710 C. elegans fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II. Show Description
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.
DZ840 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
DZ841 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
EGD615 C.elegans cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. Show Description
egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
EV343 C. elegans unc-119(ed3); efEx12. Show Description
efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
GLW33 C. elegans T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW35 C. elegans T13C2.6(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at T13C2.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
GLW39 C. elegans ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
GLW41 C. elegans nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
GLW43 C. elegans edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
GLW45 C. elegans ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
GLW47 C. elegans hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
GLW51 C. elegans cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
GLW53 C. elegans egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.
GLW57 C. elegans asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
GLW63 C. elegans pqn-59(utx51[mNG::3xFlag::pqn-59]) I. Show Description
N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3’ (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62.
GLW65 C. elegans sod-2(utx53[mScarlet::3xMyc::sod-2]) I. Show Description
N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3’ (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64.
GLW73 C. elegans H34C03.2(utx55[mNG::3xFlag::H34C03.2]) IV. Show Description
N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3’ (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72.
GLW77 C. elegans jnk-1(utx59[mNG::3xFlag::jnk-1]) IV. Show Description
N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.
GLW79 C. elegans sod-5(utx61[mScarlet-I-C1::3xMyc::sod-5]) II. Show Description
N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.
GLW85 C. elegans pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. Show Description
N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.
GLW89 C. elegans ubql-1(utx69[mScarlet-I-C1::3xMyc::ubql-1]) I. Show Description
N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.
GLW91 C. elegans hrpa-1(utx71[hrpa-1::mScarlet-I-C1::3xMyc]) IV. Show Description
C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.
GLW93 C. elegans clic-1(utx73[mScarlet-I-C1::3xMyc::clic-1]) V. Show Description
N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.
GLW95 C. elegans F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. Show Description
C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.
GOU2162 C. elegans che-3(cas443[gfp::che-3]) I; xbx-1(cas502[xbx-1::tagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2187 C. elegans klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GW1262 C. elegans xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
GW1539 C. elegans gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1623 C. elegans arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
HW1822 C. elegans lin-29(xe61[lin-29::gfp::3xflag]) II Show Description
Low penetrance Pvl (i.e., tagged protein appears not fully functional). CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to LIN-29. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., Mol Cell. 2017 Feb 2;65(3):476-489.
HW1826 C. elegans lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )
HW1835 C. elegans lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078
JCP341 C.elegans jcpSi10 II; unc-119(ed3) III. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP378 C. elegans jcpSi19 II; unc-119(ed3) III. Show Description
jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP383 C. elegans jcpSi10 II; ints-6(tm1615) IV. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP387 C. elegans jcpSi24 II; unc-119(ed3) III. Show Description
jcpSi24 [H27M09.5p::H27M09.5::3xFLAG::eGFP::H27M09.5 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP394 C. elegans jcpSi31 II; unc-119(ed3) III. Show Description
jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP405 C. elegans jcpSi37 II; unc-119(ed3) III. Show Description
jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP462 C. elegans ints-6(jcp1[ints-6::3xFLAG]) IV. Show Description
3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP519 C. elegans nxf-1(t2160) V; jcpEx6. Show Description
jcpEx6 [nxf-1p::nxf-1::3xFLAG::eGFP::nxf-1UTR]. jcpEx6 transgene rescues nxf-1(t2160) embryonic lethality at 25C. Temperature-sensitive; maintain at 25C to retain the array. nxf-1(t2160) mutants are 100% embryonic lethal at 25C. Reference: Zheleva A, et al. PLoS Genet. 2019 Sep 16;15(9):e1008338.
JH2932 C. elegans unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 C. elegans mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 C. elegans nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.