DG4213 |
C. elegans |
meg-1(tn1724[gfp::3xflag::meg-1]) X. Show Description
Superficially wild type
|
|
DG4215 |
C. elegans |
puf-5(tn1726[gfp::3xflag::puf-5]) II. Show Description
Superficially wild type
|
|
DG4218 |
C. elegans |
cpg-1(tn1728[mNG::3xflag::cpg-1]) III. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cpg-1 locus. Superficially wild type.
|
|
DG4222 |
C. elegans |
pos-1(tn1730[gfp::3xflag::pos-1]) V. Show Description
Superficially wild type
|
|
DG4228 |
C. elegans |
orc-1(tn1732[mNeonGreen::3xflag::orc-1]) III. Show Description
Superficially wild type
|
|
DG4230 |
C. elegans |
gla-3a(tn1734[gfp::3xflag::gla-3a]) I. Show Description
Superficially wild type
|
|
DG4233 |
C. elegans |
pqn-59(tn1737[gfp::3xflag::pqn-59]) I. Show Description
Superficially wild type
|
|
DG4269 |
C. elegans |
mex-3(tn1753[gfp::3xflag::mex-3]) I. Show Description
Superficially wild type
|
|
DG4324 |
C. elegans |
pod-2(tn1765[gfp::3xflag::pod-2]) II. Show Description
Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619
|
|
DG4392 |
C. elegans |
cyb-3(tn1755[gfp::3xflag::cyb-3]) V. Show Description
Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.
|
|
DG4569 |
C. elegans |
cyb-1(tn1806[cyb-1::gfp::tev::3xflag]) IV. Show Description
Viable and fertile, grows and moves well. No apparent abnormalities yet noted. Reference: Spike CA, et al. Genetics. 2022 May 5;221(1):iyac051.
doi: 10.1093/genetics/iyac051. PMID: 35377419
|
|
DQM104 |
C. elegans |
bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
|
|
DQM1051 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
DQM1066 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
DQM1068 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
DQM1070 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
DQM1072 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
DQM1152 |
C. elegans |
bmdSi243 I; ljf3(unc-34::mNG[C1]^3xFlag::AID) V; qy41(lam-2::mKate2) X. Show Description
bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
|
|
DQM455 |
C. elegans |
cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
|
|
DQM594 |
C. elegans |
bmdSi170 I. Show Description
bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069
|
|
DQM984 |
C. elegans |
bmdSi245 pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
|
|
DV3089 |
C. elegans |
rheb-1(re64[mKate2::3xFlag::rheb-1]) III. Show Description
mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression.
|
|
DV3285 |
C. elegans |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
|
|
DV3312 |
C. elegans |
rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background.
Detection with triplex primers:
HS125 5-CTTGTCACTGTAAGGGAAGATTTCC-3
HS126 5-TTGTCCTCCTCTCCCTTGG-3
HS127 5 ACGTAGAATGTTCCAGAGTTCCAG-3'
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3327 |
C. elegans |
pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3402 |
C. elegans |
ral-1(re218[mKate2::3xFlag::ral-1]) III. Show Description
Ubiquitous expression and localization to plasma membranes. Derived in an N2 background.
TD185 5 -GCCGGAAGAGTGATGAACCC- 3
TD186 5 -TAATGAGCTCGGAGACCATGGC- 3
TD187 5 -CGCACCTCATCATACATGAACTGC- 3
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3670 |
C. elegans |
rheb-1(re64 re285[AID::mKate2::3xFlag::rheb-1]) III. Show Description
AID tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous red expression.
|
|
DZ710 |
C. elegans |
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II. Show Description
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.
|
|
DZ840 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
|
|
DZ841 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
|
|
EGD615 |
C.elegans |
cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. Show Description
egxSi136 [mex-5p::tomm-20::halotag::pie-1 3UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
|
|
EV343 |
C. elegans |
unc-119(ed3); efEx12. Show Description
efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).
|
|
GLW25 |
C. elegans |
daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
GLW27 |
C. elegans |
muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
|
|
GLW29 |
C. elegans |
muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
|
|
GLW33 |
C. elegans |
T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
GLW35 |
C. elegans |
gldi-2(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
|
|
GLW39 |
C. elegans |
ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
|
|
GLW41 |
C. elegans |
nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
|
|
GLW43 |
C. elegans |
edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
|
|
GLW45 |
C. elegans |
ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
|
|
GLW47 |
C. elegans |
hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
|
|
GLW51 |
C. elegans |
cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
|
|
GLW53 |
C. elegans |
egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.
|
|
GLW57 |
C. elegans |
asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
|
|
GLW63 |
C. elegans |
pqn-59(utx51[mNG::3xFlag::pqn-59]) I. Show Description
N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3 (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62.
|
|
GLW65 |
C. elegans |
sod-2(utx53[mScarlet::3xMyc::sod-2]) I. Show Description
N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3 (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64.
|
|
GLW73 |
C. elegans |
H34C03.2(utx55[mNG::3xFlag::H34C03.2]) IV. Show Description
N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3 (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72.
|
|
GLW77 |
C. elegans |
jnk-1(utx59[mNG::3xFlag::jnk-1]) IV. Show Description
N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.
|
|
GLW79 |
C. elegans |
sod-5(utx61[mScarlet-I-C1::3xMyc::sod-5]) II. Show Description
N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3 (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.
|
|