zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.

zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.

zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.

zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.

cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.

qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.

qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3’UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.

qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3’UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.

qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.

qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.

qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.

Internal 3xMyc tag inserted into endogenous cya-1 locus.

3xMyc tag inserted at N-terminus of endogenous cyb-2.1 locus.

3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus.

Internal 3xMyc tag inserted into endogenous cyb-3 locus.

Internal 3xMyc tag inserted into endogenous cyd-1 locus.

3xMyc tag inserted at N-terminus of endogenous cye-1 locus.

3xMyc tag inserted at N-terminus of endogenous cdk-1 locus.

3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205

qSi364 [3xFLAG::fbf-2(R7/R8 loop deletion) + unc-119(+)] IV. Single-copy MosSCI insertion into oxTi177 IV. R7/R8 loop deletion removes a critical protein-to-protein interface. qSi364 is phenotypically wild-type on its own, but Mog when crossed into fbf-1(ok91) fbf-2(q704) background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus. Generated in N2 background. Reference: Ferdous AS, et al. 2023 May 1;150(9):dev201705. doi: 10.1242/dev.201705. PMID: 37070766.

q932 is 3xV5::fbf-2 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.

q983 is a 3xOLLAS::sygl-1 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus in fbf-1 null background (parental strain JK3022). Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q873[fog-3(1-262)::GGS::3xFLAG::fog-3(263 Phe)] I. qSi375 [mex-5p::eGFP::linker::his-58::3xboxb::tbb-2 3’UTR] II. The tethering assay allows this strain to be used for determining FOG-3 levels in different genetic backgrounds. Similar fertility to N2 wild type. Reference: Aoki S, et al. Cell Rep. 2018 Jun.26; 23(13):3769-3775

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

q1008 is lst-1::3xOLLAS tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.

q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q1023 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5935 fbf-2(q945[3xFLAG::fbf-2]) II. Pick GFP+ t maintain. Homozygous sterile (Mog) mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok91 q1023 homozygotes (sterile Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q1004[LST-1::3xV5] is the CRISPR-engineered insertion of a 3xV5 tag at the C-terminus of the endogenous lst-1 locus. q1032 is the CRISPR-engineered mutation C260S & C263S in the Zn finger domain of LST-1 (Haupt et al., 2019) in the q1004 background. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205.

3xV5 tag inserted into endogenous puf-8 locus via CRISPR/Cas9 engineering. Reference: Ferdous AS, et al. Development. 2023 May 1;150(9):dev201705. PMID: 37070766.

3xV5 tag inserted at C-terminus of endogenous lag-2 locus. Hermaphrodite DTC stain well. Animals are fertile and look wild-type. tracr + crRNA targeting the C-terminus of LAG-2 was injected with Cas-9 protein and repair template to insert a 3xV5 tag, following Fire and Seydoux lab RNP co-CRISPR strategy (with unc-58 crRNA and repair oligo to mark edited offspring).

qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.

3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif B disrupted (PIM B mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

GGSGG linker::3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with a deletion removing a portion of the lst-1 locus. q1115 retains the N-terminal 1-210) region of LST-1. Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motifs A&B disrupted (PIM AB mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

3xV5 tag inserted at C-terminus of endogenous apx-1 locus. APX-1 guide: GACTCGTCATCTGCTGCCATCGG. APX-1 3xV5 repair with mutation (197 nt): CCTATGGCAGCAGATGACGAGTCGTCGTTTCGAGTCGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTAGATAGTACTGGAAAGCCAATCCCAAACCCACTCCTCGGACTTGATAGCACCGGTAAGCCTATCCCTAACCCACTCCTCGGACTTGATAGCACCTAAACAACAGCTCGACGACGAGATTTACAATAATT.

qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3?UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3?UTR; the mCherry reporter 3?UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.

3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus.

3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif A disrupted (PIM A mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

3xV5 epitope tag inserted into endogenous lst-1 locus with a 1 bp deletion in lst-1L-specific first exon tospecifically disrupt LST-1L isoform. Synthetically sterile in combination with sygl-1(lf). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

q1078 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q1080 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2 with a Y479A point mutation in the R7/R8 loop. Derived by modification of parental strain JK5984 fbf-2(q1011[*q945]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.

GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.