More Fields
Strain Species Genotype
GOU2162 C. elegans che-3(cas443[gfp::che-3]) I; xbx-1(cas502[xbx-1::tagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2187 C. elegans klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GW1262 C. elegans xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
GW1539 C. elegans gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1623 C. elegans arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
HW1822 C. elegans lin-29(xe61[lin-29::gfp::3xflag]) II Show Description
Low penetrance Pvl (i.e., tagged protein appears not fully functional). CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to LIN-29. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., Mol Cell. 2017 Feb 2;65(3):476-489.
HW1826 C. elegans lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. )
HW1835 C. elegans lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078.
JCP341 C.elegans jcpSi10 II; unc-119(ed3) III. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP378 C. elegans jcpSi19 II; unc-119(ed3) III. Show Description
jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP383 C. elegans jcpSi10 II; ints-6(tm1615) IV. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP387 C. elegans jcpSi24 II; unc-119(ed3) III. Show Description
jcpSi24 [H27M09.5p::H27M09.5::3xFLAG::eGFP::H27M09.5 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP394 C. elegans jcpSi31 II; unc-119(ed3) III. Show Description
jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP405 C. elegans jcpSi37 II; unc-119(ed3) III. Show Description
jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP462 C. elegans ints-6(jcp1[ints-6::3xFLAG]) IV. Show Description
3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP519 C. elegans nxf-1(t2160) V; jcpEx6. Show Description
jcpEx6 [nxf-1p::nxf-1::3xFLAG::eGFP::nxf-1UTR]. jcpEx6 transgene rescues nxf-1(t2160) embryonic lethality at 25C. Temperature-sensitive; maintain at 25C to retain the array. nxf-1(t2160) mutants are 100% embryonic lethal at 25C. Reference: Zheleva A, et al. PLoS Genet. 2019 Sep 16;15(9):e1008338.
JDW389 C. elegans bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Show Description
Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi:
JDW460 C. elegans noah-1(wrd119[noah-1::linker::mNeonGreen(dpiRNA)::3xFLAG(internal)::linker]) I. Show Description
Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi:
JH2932 C. elegans unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 C. elegans mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 C. elegans nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH4008 C. elegans htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
JH4072 C. elegans pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JH4073 C. elegans pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JIM173 C. elegans unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM193 C. elegans ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM356 C. elegans ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
JJ2059 C. elegans unc-119(ed3) III; zuIs235. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2061 C. elegans unc-119(ed3) III; zuIs235; zuIs236. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2286 C. elegans unc-119(ed3) III; zuIs263. Show Description
zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2300 C. elegans unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2586 C. elegans cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Show Description
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.
JK4871 C. elegans fog-3(q520) I; qSi41 II. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK4942 C. elegans sygl-1(tm5040) I; qSi49 II; unc-119(ed3) III. Show Description
qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3’UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK4996 C. elegans lst-1(ok814) I; qSi69 II; unc-119(ed3) III Show Description
qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3’UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK5028 C. elegans qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5187 C. elegans fog-1(q785) I; qSi140 IV. Show Description
qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5200 C. elegans fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5731 C. elegans cya-1(q903[cya-1::3xMyc]) III. Show Description
Internal 3xMyc tag inserted into endogenous cya-1 locus.
JK5736 C. elegans cyb-2.1(q908[3xMyc::cyb-2.1]) IV. Show Description
3xMyc tag inserted at N-terminus of endogenous cyb-2.1 locus.
JK5739 C. elegans cyb-2.2(q911[3xMyc::cyb-2.2]) I. Show Description
3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus.
JK5742 C. elegans cyb-3(q914[cyb-3::3xMyc]) V. Show Description
Internal 3xMyc tag inserted into endogenous cyb-3 locus.
JK5745 C. elegans cyd-1(q917[cyd-1::3xMyc]) II. Show Description
Internal 3xMyc tag inserted into endogenous cyd-1 locus.
JK5748 C. elegans cye-1(q920[3xMyc::cye-1]) I. Show Description
3xMyc tag inserted at N-terminus of endogenous cye-1 locus.
JK5751 C. elegans cdk-1(q923[3xMyc::cdk-1]) III. Show Description
3xMyc tag inserted at N-terminus of endogenous cdk-1 locus.
JK5758 C. elegans lst-1(q895[lst-1(long)::3xFLAG]) I. Show Description
3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK5842 C. elegans fbf-2(q932) II. Show Description
q932 is 3xV5::fbf-2 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5893 C. elegans sygl-1(q983[3xOLLAS::sygl-1]) I. Show Description
q983 is a 3xOLLAS::sygl-1 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.