More Fields
Strain Species Genotype
YQ95 C. elegans unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
YY178 C. elegans ggIs1. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)]. Unknown if unc-119 is still in background. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
ZB1102 C. elegans glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Mano & Driscoll (2009) J Neurochem 108(6):1373-84.
ZB1106 C. elegans glt-3(bz34) IV; glt-1(ok206) X. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZB1108 C. elegans bzEx?. Show Description
bzEx? [glt-3::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZB1110 C. elegans bzEx?. Show Description
bzEx? [glt-4::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZD202 C. elegans sek-1(km4) X; qdEx8. Show Description
qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
ZG119 C. elegans unc-119(ed3) III; iaIs7 IV; vhl-1(ok161) X. Show Description
iaIs7 [nhr-57p::GFP + unc-119(+)] IV. Over-expression of nhr-57:GFP in vhl-1 mutant background. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.
ZG120 C. elegans unc-119(ed3) III; iaIs7 IV. Show Description
iaIs7 [nhr-57p::GFP + unc-119(+)] IV. GFP expression is very weak. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.
ZG443 C. elegans iaIs7 IV; egl-9(ia58) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG444 C. elegans iaIs7 IV; egl-9(gk277) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. nhr-57p::GFP is expressed at low levels. Superficially wild-type. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG448 C. elegans iaIs7 IV; egl-9(ia60) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG449 C. elegans iaIs7 IV; egl-9(ia61) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG492 C. elegans iaIs7 IV; egl-9(ok478) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG494 C. elegans unc-119(ed3) III; egl-9(sa307) V; iaIs38. Show Description
iaIs38 contains [egl-9p::egl-9::tag + unc-119(+)]. Superficially WT. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG580 C. elegans unc-119(ed3) III; iaIs28. Show Description
iaIs28 contains [hif-1p::hif-1a::tag + unc-119(+)]. Published in Zhang et al PLoS ONE 4: e6348 (2009).
ZG583 C. elegans iaIs34. Show Description
iaIs34 contains [hif-1p::hif-1a (P621G)::tag + unc-119(+)]. Published in Zhang et al PLoS ONE 4: e6348 (2009).
ZG601 C. elegans iaIs21. Show Description
iaIs21 [gcy-35p::GFP + unc-119(+)]. gcy-35::GFP is expressed in fifteen neurons, all of which also express ahr-1: AQR, PQR, URXR/L, ALNL/R, BDUL/R, SDQL/R, PLML/R, AVM, and two neurons in the tail tentatively identified as PLNL/R. gcy-35::GFP is only transiently expressed in PLML/R during the first larval stage.
ZG610 C. elegans iaIs25. Show Description
iaIs25 [gcy-37p::GFP + unc-119(+)]. gcy-37::GFP is consistently expressed in AQR, PQR, URXL. and URXR neurons. Expression also observed in AVM and two unidentified neurons located in the head.
ZG629 C. elegans iaIs22. Show Description
iaIs22 [gcy-36p::GFP + unc-119(+)]. gcy-36::GFP is consistently expressed in AQR, PQR, URXL and URXR neurons.
ZG686 C. elegans unc-119(ed3) III; egl-9(sa307) V; iaEx101. Show Description
iaEx101 contains [egl-9p::egl-9(H487A)::tag + unc-119(+)]. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZM10113 C. elegans twk-40(bln282[twk-40::TagRFP::ZF]) III; hpIs727. Show Description
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated tagged allele of endogenous twk-40 locus inserting TagRFP and a ZIF-1 directed degron to the endogenous TWK-40, allowing visualization of endogenous protein expression and localization as well as targeted degradation. The presence of hpIs727 in the background leads to specific degradation of TWK-40 from AVA, causing loopy forward and reversal movement compared to twk-40(bln282) alone.
ZM10410 C. elegans gbb-2(tm1165) IV; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10743 C. elegans unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM11006 C. elegans ljIs131; hpEx4340. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.
ZM11020 C. elegans ljIs131; hpEx4343. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.
ZM11034 C. elegans hpIs819; hpIs810. Show Description
hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA).
ZM11039 C. elegans hpEx4351. Show Description
hpEx4351 [npr-4p::ins-22::GFP]. Pick animals with green fluorescence in VNC to maintain. Additional GFP expression in coelomocytes.
ZM11082 C. elegans twk-40(hp834) III; hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone.
ZM11084 C. elegans hpEx4363. Show Description
hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain.
ZM11085 C. elegans hpIs814; hpEx4363. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA.
ZM11086 C. elegans hpEx4362. Show Description
hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate.
ZM11151 C. elegans hpIs758; hpIs814. Show Description
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min.
ZM11177 C. elegans hpIs860. Show Description
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).
ZM11207 C. elegans twk-40(bln336) III; hpIs860. Show Description
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. twk-40 gain-of-function allele. Paralyzed, no backward movement upon head touch. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).
ZM11208 C. elegans twk-40(hp834) III; hpIs860. Show Description
hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Loopy movement with increased reversals. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA).
ZM11284 C. elegans twk-40(bln336) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background.
ZM11285 C. elegans twk-40(hp834) III; hpEx4479. Show Description
hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background.
ZM11286 C. elegans hpIs636; hpEx4479. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites.
ZM1157 C. elegans daf-2(e1370) III; juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM5488 C. elegans hpIs202. Show Description
hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM6523 C. elegans hpDf761 II; unc-119(ed3) III. Show Description
hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM7419 C. elegans hpIs363. Show Description
hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZT22 C. elegans fjSi1 II; csr-1(fj54) IV. Show Description
fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT24 C. elegans vsra-1(tm1637) I; fjSi3 II. Show Description
fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT49 C. elegans ego-1(fj114[PA::ego-1]) I. Show Description
Four amino-acid residues (G24–V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT56 C. elegans fjSi19 II; unc-119(ed3) III. Show Description
fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT58 C. elegans fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT64 C. elegans csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT65 C. elegans him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.