More Fields
Strain Species Genotype
VH7111 C. elegans exos-8(hd7091 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7091 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7091 and CGC66. hd7091 is a 5126 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7115 C. elegans F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7116 C. elegans adah-1(hd7105 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7117 C. elegans ndub-3(hd7109 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7109 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7109 and CGC66. hd7109 is a 472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7120 C. elegans ubh-1(hd7120[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAATAGCTTACTATTAGCTAGAAAATCCG; Right flanking sequence: GAGCGGCCATATTTAGACAGTTTTTTTGGTTCT. sgRNA #1: GGTTGGAATTGAGGAACGTT; sgRNA #2: TTCGAGCGGAGTCCATGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7121 C. elegans Y71A12B.10(hd7121[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCGGAGACACTACACCTTCGAGACTCCT; Right flanking sequence: TGGTGCTCAATGTGCAGTGGCGTTTGGCTC. sgRNA #1: TCTTCAGTATATCCATTCGG; sgRNA #2: CGACTTGACGCTCATCGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7122 C. elegans +/mT1 [umnIs52] II; C34E10.10.1(hd7100 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7100 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7100 and CGC66. hd7100 is a 572 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7123 C. elegans enol-1(hd7101 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7101 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7101 and CGC66. hd7101 is a 1562 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7126 C. elegans jmjd-4(hd7126[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACAGATCTACACAATCCTGGAGCTCCT; Right flanking sequence: AGGCTCATTTTTGAAGCCGAATTTTACTAA. sgRNA #1: CACGAACATCTAGCTCCCTC; sgRNA #2: CTCCACTCGCCAAGGATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7130 C. elegans +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ tsen-2(hd7124 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7124 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7124 and CGC66. hd7124 is a 3032 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTATCAATGCTTTTTTATTGTGTGACAAGA; Right flanking sequence: CGCGAAAAATTCCAGGTTTTTTCCCATTTT. sgRNA #1: TTCGCGTGAGAGTTAGAAGC; sgRNA #2: CTCCATTGACAATCGTCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7131 C. elegans +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ Y66D12A.7(hd7125 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7125 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7125 and CGC66. hd7125 is a 1024 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATCACATTCAAATCGAATCGTTCCTTCGAC; Right flanking sequence: TCCTTCTCCAAATCTTCTTATTATCCGTGT. sgRNA #1: TCGAGCGGCAGATTTCCCGG; sgRNA #2: AAACGAAAAACGCCATTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7132 C. elegans +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ZK632.14(hd7127 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7127 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACAGTACTCTTTAAAGGCTCTCAATCTTGT; Right flanking sequence: TGGAAAAGCAGACAAAAAAGGCGAGAAGAA. sgRNA #1: CATTCTACAAAAATGTATCG; sgRNA #2: GTGATTCGTACCTCACATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7133 C. elegans +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/tpk-1(hd7129 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) III Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7101 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTTTGCCTCAGAGTAATAATAAGCTAAACA; Right flanking sequence: GGGATTCAAATCTTGATGTCAATCTTGAAA. sgRNA #1: TTTTAACCCCTCATCACAAG; sgRNA #2: CATTAAGAGTTAAATTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7135 C. elegans Y62E10A.13(hd7128[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 7162 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTACACCTTCTCTAATGACATTTCCACCG; Right flanking sequence: TATTATCAGCTGCTGATACAGATAAAAGGA. sgRNA #1: AATCCAATGAATGCATCAGC; sgRNA #2: ACTACATCACAGACTGTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7138 C. elegans W03D8.8(hd7138[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3086 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAAGAAGCTTTTCAACCACCCGCCTCCCT; Right flanking sequence: AGGACACATTATGGAGCCACCATACTTCCC. sgRNA #1: GTTATCAATCACACGACTGG; sgRNA #2: CAGGTTGAACTAGTGAATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7140 C. elegans nsun-2(hd7140[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 14229 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATAAGGAGCAGAATGTCTTTCCATTGGA; Right flanking sequence: AGGACATGCTTTTCATGCTGAAATCCGACG. sgRNA #1: GCAATTTGACGAGTTTCGGG; sgRNA #2: AAAAGTCAAGATTGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7141 C. elegans F19C7.8(hd7141[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 15206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATGGTAGGTCTTTCAAGCCTGCGTGCCT; Right flanking sequence: CTTTGGGTCACCTTATGAGACATGACCGGT. sgRNA #1: TAGAAAACTAGTCATGAGGG; sgRNA #2: CGCTGAGGGATCAATGTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7142 C. elegans adh-5(hd7142[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 3554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGCAGGGAAATGGATTTATGCCCGATGGT; Right flanking sequence: AGGTCCGCAAAACCCCAGGAAAAAAGTCTA. sgRNA #1: TCATCGAGATTCACATGCAA; sgRNA #2: AGCTACTAGAACTTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7143 C. elegans F37A4.1(hd7143[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1516 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACTTGTACAGTCGAGACTGGCTCACACCA; Right flanking sequence: CTGCAGTTGATGATCAACCCGAGAATGTTC. sgRNA #1: AGAATTGTCAGCATTCCAGC; sgRNA #2: TGGTCAGAATCTCTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7145 C. elegans hsd-2(hd7145[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGAGGAAGCTGATTAAATTTTCGAAATG; Right flanking sequence: CGACTTTATAAAAGCCGTTGTACCATATTT. sgRNA #1: GGCCACTATGTTATAGTCGG; sgRNA #2: CCATCGTTCTATACTCCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7148 C. elegans gst-23(hd7148[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1144 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTACAGTTCACAATCGCGTCACACCC; Right flanking sequence: GGGGACAAGCTGAGCTATGCAGATTATGCT. sgRNA #1: CGAAAATATAATCGGGTTAG; sgRNA #2: ACGGCGAAAACTTTGTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7149 C. elegans W01C8.5(hd7149[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGGAGCTCGTCAACGATGAAAATTCTGCCA; Right flanking sequence: ACCTCTTATGCAATTCCAAAACAATTTTCT. sgRNA #1: GGAAACAACTTCAACATGGG; sgRNA #2: GACAGATGGCCTCAGTTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH715 C. elegans hdIs17 I; hdIs10 V; nre-1(hd20) lin-15B(hd126) X. Show Description
hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.
VH7150 C. elegans aprt-1(hd7150[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1154 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCATCTTTTATATGCAAATATATTCCT; Right flanking sequence: CGTATGTGAAAGAATATGGAGAGGATCGGG. sgRNA #1: CATTATAAATTGTGGAAGGG; sgRNA #2: ATGCTTCAATCGTTGCTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7152 C. elegans ugt-10(hd7139[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATCAAATTCATTTTTGGATCAATCGGTT; Right flanking sequence: TGGGTTATTCATAAGGTGTGAGTCCCAAAA. sgRNA #1: GTTTTAGGAGCACATCACGG; sgRNA #2: ATCATCACGGCAGACACAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7153 C. elegans F10D2.8(hd7153[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCTACATTCAGGGGTGTTTTTTCATATCT; Right flanking sequence: CGGCAATTGTCGCAAAAAATTTGGTGTGAC. sgRNA #1: CAAAGCTATGATGTGGTCCA; sgRNA #2: GCCAGCGTCTGTTAGAGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7154 C. elegans hsp-60 (hd7146 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7155 C. elegans apr-1 (hd7144 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) /hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7144 and CGC92. hd7144 is a 5280 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTGAAGAATAGCAGCAAAAACGGTCACCT; Right flanking sequence: ATTACTTTTTTTTAAAAAGTACAGTATCAA. sgRNA #1: ACAGGTGTTTACAATGCGAG; sgRNA #2: TATTTTCTTACAGTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7156 C. elegans +/nT1 [umnls49] IV; ncx-2 (hd7147 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7147 and CGC63. hd7147 is a 7691 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCAATTCTTCAATTTTTCCAATTCTTC; Right flanking sequence: TCTTTTCTGGTCGACAAAGGTGCCTAAATC. sgRNA #1: ATAAAGTGAAGATTGGTGGG; sgRNA #2: AACAGTGTTTTGGGGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7158 C. elegans R05G6.5(hd7158[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGTTCAAAGGCAAGCACATTGGCGCGGC; Right flanking sequence: TGGAATATATTATTCAAAAACGACAATTGC. sgRNA #1: GACCGCCCGTCTCGAGACAT; sgRNA #2: TTCAGAATGAGTTCAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7159 C. elegans Y50D7A.13(hd7159[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACGATGGAACCATCACCAGACGGTCAACT; Right flanking sequence: TTTTCTCATTTTTCTCATCGTCGATGCATT. sgRNA #1: CGAGATAATCGCAAATTCAG; sgRNA #2: CCACATATGTTATCAAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7162 C. elegans F47D12.7(hd7162[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 3115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGTGGACGGTTTTGTGGGCATAATGCAT; Right flanking sequence: CCACTCCCCTTTTTCGGAAATTGGAAAACG. sgRNA #1: CACATTTCACGCACAGAAGA; sgRNA #2: TGAACGAAAGATTAACGGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7163 C. elegans +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ula-1(hd7157 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7165 C. elegans ps-25&sf1=all">mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54UTR + ps-2&sf1=all">rps-2 7p::neoR::unc-54UTR + loxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7166 C. elegans ncap-1(hd7160[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGGCCTCCAGTAGATGCTCCAGGAGCCG; Right flanking sequence: CGGGATGCGATACACGAAAACCTTGGGTTT. sgRNA #1: TGCAGTTTCCCGCCCTCGTC; sgRNA #2: TGACCGCTGGTTCCGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7167 C. elegans gsto-3(hd7161[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 3555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAACTGTGGATAGAATTAGGGGTGGACGAA; Right flanking sequence: AATATAGTATTATAGGACCGAAAATATAGA. sgRNA #1: AAACGATTTACTCCGGCTAT; sgRNA #2: CAAAAAATTAGCGTCTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7168 C. elegans F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7169 C. elegans mdh-1(hd7169[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7171 C. elegans cyp-33C8(hd7171[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7172 C. elegans Y71H2AM.6(hd7172[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7173 C. elegans +/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/nT1 V Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7174 C. elegans atg-5(hd7174[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7176 C. elegans fubl-4(hd7176[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAAACTTTAATAGATACATTTTTGGC; Right flanking sequence: ATACGCTTCTACAATACAACAATCGTTGAA. sgRNA #1: AAAATTACGCCAAACCTGCT; sgRNA #2: ACATTTGAATTATGTTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH725 C. elegans pha-1(e2123) III; hdEx231. Show Description
hdEx231 [C16C10.10::GFP + pha-1(+)]. Ubiquitous expression of glyoxalase-1::GFP. Maintain at 25 C. Reference: Morcos M et al. (2008) Aging Cell 7(2):260-9.
VIG3 C. elegans unc-119(ed3) III; pmcIs1. Show Description
pmcIs1 [ant-1.1p::ant-1.1::GFP + unc-119(+)]. Expression of ant-1.1::GFP under ant-1.1 promotor (Farina et al., Dev Dyn 2008) in most tissues including the gonads and in the spermatozoa. GFP intensity is low and unstable. GFP positive worms should be selected under fluorescence microscope. ant-1.1::GFP expression seems to be more stable when worms are grown at 24°C and in the dark. Reference: Al Rawi S, et al. Science. 2011 Nov 25;334(6059):1144-7.
VJ311 C. elegans erm-1(tm677)/unc-63(x18) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and erm-1 homozygotes which grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
VK1093 C. elegans vkEx1093. Show Description
vkEx1093 [nhx-2p::mCherry::lgg-1]. Maintain by picking mCherry+ animals. Increased puncta under autophagy conditions. Reference: Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460.
VK1104 C. elegans vkEx1104. Show Description
vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1241 C. elegans vkEx1241. Show Description
vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1243 C. elegans vkEx1243. Show Description
vkEx1243 [nhx-2p::ubiquitin-V::mCherry + myo-2p::GFP]. Increased Ub-tagged mCherry accumulation upon blockage of the proteosome by RNAi. Faint mCherry expression in intestine. GFP+ pharynx. References: Miedel MT, et al. PLoS One. 2012;7(7):e40145. Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460. Dantuma NP, et al. Nat Biotechnol. 2000 May;18(5):538-43.