More Fields
Strain Species Genotype
JMC213 C. elegans prg-1(tor149[GFP::3xFLAG::prg-1]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous prg-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC217 C. elegans rde-1(tor153[GFP::3xFLAG::rde-1]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous rde-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC219 C. elegans wago-1(tor113[GFP::3xFLAG::wago-1]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous wago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC227 C. elegans sago-2(tor121[GFP::3xFLAG::sago-2c]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous sago-2; specifically tags c-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC229 C. elegans sago-1(tor123[GFP::3xFLAG::sago-1]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous sago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC237 C. elegans nrde-3(tor131[GFP::3xFLAG::nrde-3]) X. Show Description
GFP and 3xFLAG tags inserted into endgonenous nrde-3 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC247 C. elegans nrde-3(tor134[3xFLAG::nrde-3]) X. Show Description
3xFLAG tag inserted into endgonenous nrde-3 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC248 C. elegans wago-10(tor162[3xFLAG::wago-10] V. Show Description
3xFLAG tag inserted into endgonenous wago-10 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC273 C. elegans wago-1(tor163[3xFLAG::wago-1] Show Description
3xFLAG tag inserted into endgonenous wago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC327 C. elegans vsra-1(tor170[3xflag::vsra-1]) I. Show Description
3xFLAG tag inserted into endgonenous vsra-1/C04F12.1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
MG152 C. elegans xsIs3 I. Show Description
N2 with integrated array pJH4.52. xsIs3[hisH2B::GFP; rol-6(su1006)]. 39.9.1 Must be kept at 25C to avoid germline-silencing.
MT14390 C. elegans let-418(n3536) V. Show Description
Temperature sensitive allele of let-418. Viable at 20C. Sterile and partially Muv at 22.5C. Larval lethal at 25C.
OH10667 C. elegans pha-1(e2123) III; otEx4767. Show Description
otEx4767 [trp-1p(1.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10722 C. elegans pha-1(e2123) III; otEx4804. Show Description
otEx4804 [twk-13p(2.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH18011 C. elegans pha-1(e2123) III; otEx7947. Show Description
otEx7947 [W02A2.5p::GFP + pha-1(+)]. I3 neurons are labeled with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
PHX1048 C. elegans hdl-1(syb1048[hdl-1::gfp]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous hdl-1 locus by CRISPR. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PHX1812 C. elegans cfi-1(syb1812[cfi-1(delta_enhancer)::mNG::AID]) I. Show Description
A4e enhancer was deleted in endogenously-tagged cfi-1(kas16[mNG::AID::cfi-1]). Expression of cfi-1::mNG::AID is lost in VNC motor neurons. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
PHX1856 C. elegans cfi-1(syb1856[cfi-1(mut_COE)::mNG::AID]) I. Show Description
Eight COE motifs in A4e were mutated in endogenously-tagged cfi-1(kas16[mNG::AID::cfi-1]). Expression of cfi-1::mNG::AID is down-regulated in late larval stages and adults. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
PHX6129 C. elegans ieSi57 II; Y47D3A.21(syb6129[GFP::AID:::3Xflag::3xGAS::Y47D3A.21]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206.
PHX6451 C. elegans tph-1(syb6451[tph-1::SL2::GFP::H2B]) II. Show Description
Endogenous tph-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PHX6486 C. elegans cat-1(syb6486[cat-1::SL2::GFP::H2B]) X. Show Description
Endogenous cat-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PHX7278 C. elegans unc-46(syb7278[unc-46::SL2::GFP::H2B]) V. Show Description
Endogenous unc-46 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PHX7290 C. elegans snf-3(syb7290[snf-3::tagRFP::SL2::GFP::H2B]) II. Show Description
Endogenous snf-3 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PHX7566 C. elegans unc-47(syb7566[unc-47::SL2::GFP::H2B]) III. Show Description
Endogenous unc-47 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PHX7768 C. elegans tdc-1(syb7768[GFP::linker::H2B::T2A::tdc-1]) II. Show Description
Endogenous tdc-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PHX7786 C. elegans tbh-1(syb7786[tbh-1::SL2::GFP::H2B]) X. Show Description
Endogenous tbh-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
PS9666 C. elegans syIs300; syEx1712. Show Description
syEx1712[T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
PS9896 C. elegans syIs852; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs852 [C50F7.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PX740 C. elegans fxIs47 II. Show Description
fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
RB1243 C. elegans T22H2.5a(ok1308) I. Show Description
T22H2.5a Homozygous. Outer Left Sequence: aactagaagaaatgggcggg. Outer Right Sequence: catttttgtgcaagctcacg. Inner Left Sequence: ttaacaaggaaatgtgggcg. Inner Right Sequence: ccagaactttcctcctgctg. Inner Primer PCR Length: 2122. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB707 C. elegans pqn-21(ok486) I. Show Description
C37A2.5a. Homozygous. Outer Left Sequence: TTGTGGTTCGGTGTGTGTTT. Outer Right Sequence: TGGTTCTGTGCTGAAAGACG. Inner Left Sequence: GGGAGAGGATGCAACAAAGA. Inner Right Sequence: TGCTCCAGCTTTGAGGATTT. Inner primer WT PCR product: 2940. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW11797 C. elegans unc-119(tm4063) III; stIs11797. Show Description
stIs11797 [C37A2.5a::H1-wCherry + unc-119(+)].
RW11816 C. elegans unc-119(tm4063) III; stIs11816. Show Description
stIs11816 [F54F2.5b::H1-wCherry + unc-119(+)].
RW11952 C. elegans unc-119(tm4063) III; stIs11952. Show Description
stIs11952 [F29F11.5a::H1-wCherry + unc-119(+)].
SD1424 C. elegans unc-119(ed3) III; gaIs228. Show Description
gaIs228 [C26B9.5p::his-24::mCherry + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).
SD1583 C. elegans ccIs4251 I; stIs10373. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10373 [C50F7.5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
STR237 C. elegans unc-44(hrt2) IV. Show Description
Severely Unc. CRISPR-generated deletion removes 111 bp (ACGATAAGAAAACTA...ATGAATCCGCCCAAG). hrt2 allele is specific to the AO13 unc-44 isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
STR318 C. elegans unc-119(ed3) III; hrtSi28 IV. Show Description
hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
STR369 C. elegans hrtSi41 I; unc-119(ed3) III. Show Description
hrtSi41 [des-2p::unc-33L::GFP + unc-119(+)] I. hrtSi41 inserted into ttTi4348. UNC-33L::GFP expression in PVD and FLP. Functional UNC-33::GFP fusion with internal GFP tag inserted at the start of the S isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
STR512 C. elegans hrtSi69 I; unc-119(ed3) III. Show Description
hrtSi69 [des-2p::GFP::unc-33s + unc-119(+)] I. hrtSi69 inserted into ttTi4348. GFP::UNC-33S expression in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
STR536 C. elegans hrtEx161. Show Description
hrtEx161 [des-2p::PA-GFP::tba-1 + des-2p::mKate2 + unc-119(+) + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. PA-GFP::TBA-1 expression in PVD and FLP; fluorescence can be induced illumination by blue light. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
TY1652 C. elegans cha-1(y226) IV. Show Description
Temperature sensitive. Wild type at 15C; lethal at 22.5C.
UT1306 C. elegans akt-1(mm200) V. Show Description
Benzaldehyde/starvation learning defective. mm200 is a single base pair change resulting in an L199F substitution. Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
UT1343 C. elegans crh-2(gk3293) II; crh-1(tz2) III. Show Description
Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
VC316 C. elegans +/mT1 II; npp-10(ok467)/mT1 [dpy-10(e128)] III. Show Description
ZK328.5b. Heterozygotes are sickly WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok467 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC538 C. elegans +/szT1 [lon-2(e678)] I; gar-1(gk269)/szT1 X. Show Description
C15B12.5a. Apparently lethal deletion balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males (szT1 hemizygotes) and gk269 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC616 C. elegans dab-1(gk291) II. Show Description
M110.5a. Mild Dpy, sometimes Unc, accumulates eggs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC638 C. elegans spk-1(ok706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0464.5a. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC687 C. elegans dur-1(ok1010) IV. Show Description
F25H8.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC716 C. elegans rig-6 (ok1188) II. Show Description
C33F10.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807