More Fields
Strain Species Genotype
VC4335 C. elegans lpd-6(gk5418[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3234 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAAATCCTCCATCACGATCTCCCGATCTTC. Right flanking sequence: CTGACGACAAGTTTTTTACCGCGATTTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4337 C. elegans lat-1(gk5420[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5039 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 11293 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTCTCCTCTATGCTTTCTCTAGTTTTGCCT. Right flanking sequence: GACGGTGCTTCGAATTGATTTGAACAAGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4339 C. elegans ugt-66(gk5422[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2473 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTTCAAAATATTAAATGAAGCCGTTG; Right flanking sequence: CAGGGAGGTGTCACAATTATTTGTGTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC434 C. elegans glh-4(gk225) I. Show Description
T12F5.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4341 C. elegans atp-5(gk5424[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 848 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAAGAAGGGGGTATCGACTGCATAAGCTC. Right flanking sequence: CACGGAAGACGTCGCTACCCTCTTAGCGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4343 C. elegans T09B4.5(gk5426[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGCACAGGCATTCACTGTTCTTTCCTGCT. Right flanking sequence: ACTGGCTCGCTGCTGCGATGATCATTGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4344 C. elegans T24B8.4(gk5427[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 7128 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAAAAAGAAGACGAATAAGAACTAAATAG. Right flanking sequence: CCTTGGCCAATCGATCGAAGCTCCTGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4349 C. elegans bud-31(gk5432[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1392 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACGGAACTTCCACCATTCTGTGAATTATA. Right flanking sequence: GTAGAACGGTGTCCAGCCATTATAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC435 C. elegans +/szT1 [lon-2(e678)] I; hum-6(ok632)/szT1 X. Show Description
T10H10.1. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, WT males, and homozygous ok632 hermaphrodites (arrest stage/phenotype undetermined). WT males apparently are viable ok632 hemizygotes, as they are positive for ok632 by PCR. Lon males negative for ok632 by PCR. Viable homozygous ok632 hermaphrodites have not been recovered. Pick WT L4 hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4350 C. elegans F54F7.3(gk5433[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 858 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCAAAGAAATACGTTTATGTAAGAGT; Right flanking sequence: GGGAAAAAAACAGTGAATAATATAGTTATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4353 C. elegans F10E9.2(gk5436[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GAAATTTGTTCAGTACTGGAATGAATTCCT; Right flanking sequence: AGGAGAAGAAAGAGAAGAAAAGTGCGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4354 C. elegans T21B4.3(gk5437[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 854 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGACATAGGATTTCATCGATCACAAGACCG; Right flanking sequence: GGGAGTGTAGAAGTGAAGTCAATTGATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4356 C. elegans M01G5.1(gk5439[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 10206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCGATGCCAAATCATGTGGCAGCTCAA. Right flanking sequence: GGGGAATTCGAATTTCTTAATGGCTTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4357 C. elegans ZK185.3(gk5440[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2074 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTTTCTCCGTGTACCTCTTTGTACCAATG; Right flanking sequence: GGCGGCTGAATGCGATCTTTTCCAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4360 C. elegans Y48E1C.2(gk5443[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 4099 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTAAATTTTCAGATGGAAGAGCAGGAGCC; Right flanking sequence: GCCATCTACTCGACCCTCGAACCCGGCGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4361 C. elegans sucg-1(gk5444[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGATTTTTAAGATTAATAATGCTTCGTGCT. Right flanking sequence: GGAGGTGAACCAGCAAACTTCCTCGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4364 C. elegans srr-7(gk5446[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2103 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTATGTATGAGCTCTTTTGGAATAGACAC. Right flanking sequence: CGCGGTTTTTTTTTCAAATTTGTATTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4366 C. elegans srg-1(gk5448[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1163 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAATTTTTTGATTTTGAGTTGCCGAAGTAA; Right flanking sequence: CGGCATTCGGTATTCAGCTTCAATTTTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4369 C. elegans Y55F3BR.1(gk5450[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8878 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTGTATTTCAGTCCCGAATCCTGCAAAAA; Right flanking sequence: CACTATTTTCTTATCAAATTCCGTGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4370 C. elegans oac-19(gk5451[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3916 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TACTCTCAAGTTGAGATGTGGTTGCCATTA; Right flanking sequence: CAGACAATGACCAGGTATGTGTGAAGATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4371 C. elegans Y41C4A.7(gk5452[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 751 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACATCACGAATTTGTCGCCGTTTCCGGTT; Right flanking sequence: TCAACGGGTAAGTCTTGTGTGCCTGCCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4372 C. elegans W01A8.6(gk5453[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2231 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTACTGTCTGCTGATGTTCCGTTTGTA; Right flanking sequence: CTCACCAGGAATAGGAGAAATGAAAATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4374 C. elegans F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5005 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2246 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4376 C. elegans stip-1(gk5457[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5006 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3229 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4379 C. elegans Y43F8B.22(gk5460[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 697 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTATCAACGAAAAATCTTCACAGTTCCA; Right flanking sequence: AGAACTAAGATAAGTGCTATTCCATCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4380 C. elegans rpl-10(gk5261[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128)] II. Show Description
Homozygous lethal or sterile deletion balanced by mIn1. Deletion of 772 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous mIn1 is non-GFP fertile Dpy-10. Left flanking sequence: TTCTCTTCTATATATATATATTCTCCGTTT; Right flanking sequence: TAATTTGGTATCCACTGTATTTGTTGAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4381 C. elegans cpsf-3(gk5271[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC9 IV. Show Description
Homozygous lethal or sterile deletion balanced by tmC9. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC9 is non-GFP Mec-3 Unc-31. Left flanking sequence: GTGCCAATTTTCCAATTACTTTTGCCGTTT; Right flanking sequence: CATGGAAGTGCACCACAATGATCCAAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4382 C. elegans ptr-1(gk5276[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC3[egl-9(tmIs1230)] V. Show Description
Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4383 C. elegans cutl-13(gk5461[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7739 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATAGAGAAGGATAATTTTTTAGGCCTCGG; Right flanking sequence: GAAGGATATTATCTAAGCAAACACTGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4385 C. elegans let-49(gk5463[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 890 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGCACAAACAGTCAGCCCGTTCCCAAAT. Right flanking sequence: GACGGAGTGCTTCATATGCTTCAGGAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4387 C. elegans col-35(gk5465[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1640 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGCCATCTCAATATCTTTTTTTGCCACCG; Right flanking sequence: GAGTGATGTTTTCTTCCATTTCCACTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4389 C. elegans tftc-5(gk5467[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5031 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2935 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4390 C. elegans glb-4(gk5468[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5007 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5263 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4391 C. elegans clec-266(gk5469[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAGATCGAGTAGAACTTGAAAGAGCATG. Right flanking sequence: AGCACTTCAAAAGTTTCGAGTGTTTTATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4393 C. elegans iars-2(gk5471[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5018 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3877 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAATATTCGAACTTCTCGATGGTCCACCA; Right flanking sequence: ATAGAAAACAGGATTTGATGTTGAAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4394 C. elegans pes-4(gk5472[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7706 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGATAAAAAGGTGAGAAAATAGAGAAACGT; Right flanking sequence: TGGTGCAGGTGATGAATAATTTTCTCCCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4395 C. elegans B0432.10(gk5473[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1618 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGGTTTTTGTGGATCATATCGTACGGATT. Right flanking sequence: ATGAAATCCGTGATAAACTCGAAATTCGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4396 C. elegans lron-13(gk5474[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 9122 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAACACCGCCACGACAAATTTAACAGAAT. Right flanking sequence: CTTGGGAACAATCTCCAGCGCACAATTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4398 C. elegans C14B9.10(gk5476[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5032 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1853 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4399 C. elegans Y48A5A.3(gk5477[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 562 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAATAATCAATAAAGTATCGATTTTTCCG; Right flanking sequence: TGAAAAAACATTAAAAATAGCGGTTATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4400 C. elegans F28D9.4(gk5478[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5019 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2626 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4402 C. elegans T04D3.8(gk5480[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 909 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GACGAAAAATCCAAATACATAACGAGACCC; Right flanking sequence: GGACTCAATTTCGACTATTTCCTGTTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4403 C. elegans hrpr-1(gk5481[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5020 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2871 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. [NOTE: VC4403 exhibits weak red fluorescence. The cause of this fluorescence is unknown, but gk5481 is a clean deletion/insertion confirmed by PCR.] Left flanking sequence: TTGCTTTCAGGCAATCGTCACGCTCGTTGA; Right flanking sequence: GGCGGGAGATCTGCAAAAATCGATAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4404 C. elegans F45G2.10(gk5482[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5033 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2468 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4406 C. elegans Y54F10AL.1(gk5484[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4078 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCTAATCCCGCACCCACACGTAATGCAGA. Right flanking sequence: GGTGGTGGAGTTGCTTCTCAGTAAGGAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4408 C. elegans C13F10.7(gk5486[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGAGAAAATATTAATGTGGAGGTGGTTACT; Right flanking sequence: GATGGGTTTTATAGAAAAATTATCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4411 C. elegans amt-2(gk5489[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATGAATATTAGGATTTTCTCCGTTCCAGTG. Right flanking sequence: GCATGCCAACCTGATTATCGACAAGTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4413 C. elegans R02F11.3(gk5491[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2082 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAAAAATTCCAGCAATTCAACCGTAC. Right flanking sequence: AGCCGGTGCTATTGTGGTTTCTATGTACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4414 C. elegans egl-17(gk5492[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGCTGTGAAAATCGTTTTACAGGCATCCA. Right flanking sequence: ATTTGTCCATCATGCAGTTCGTTCAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4416 C. elegans cest-31(gk5494[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2081 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCACTTCTGAATGTTTTAAACTCGACATGC; Right flanking sequence: AATCTCTCCTCTCGTGTTTTGAAAATTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.