More Fields
Strain Species Genotype
CB1255 C. elegans vab-11(e1255) IV. Show Description
Blebs on tail of adult hermaphrodite. Tail irregular, tail cuticle sometimes separated, tail spike sometimes truncated. Some animals have enlarged excretory canals.
CB1256 C. elegans him-3(e1256) IV. Show Description
Throws 11% males.
CB1322 C. elegans lin-8(n111) II; lin-9(n112) III. Show Description
Multivulva.
CB1511 C. elegans him-10(e1511) III. Show Description
Temperature sensitive. 2% XO self-progeny at 15C, 12% at 20C, and 27% at 25C. M-MATING++++ >30%WT.
CB1611 C. elegans mec-4(e1611) X. Show Description
Mechanosensory abnormal. Touch insensitive. Dominant. Cells become vacuolated and die.
CB2030 C. elegans unc-62(e644) dpy-11(e224) V. Show Description
UncDpy.
CB2065 C. elegans dpy-11(e224) unc-76(e911) V. Show Description
DpyUnc.
CB207 C. elegans dpy-11(e207) V. Show Description
Severe dumpy (piggy), grows poorly. Behaves as a null allele. Sequenced: early nonsense mutation R4opal.
CB211 C. elegans lev-1(e211) IV. Show Description
Levamisole resistant. Recessive. Marginally Unc-No sin wave. WT adults.
CB2194 C. elegans dpy-11(e224) eDp22 V. Show Description
Dpy.
CB2203 C. elegans unc-54(e190) I; dpy-11(e224) eDp22 V. Show Description
Dpy. Movement Slow. Unc partially suppressed.
CB2221 C. elegans unc-54(e1315) I; dpy-11(e224) eDp23 V. Show Description
Dpy. Movement Slow. Unc partially suppressed.
CB224 C. elegans dpy-11(e224) V. Show Description
Dpy. Recessive. Mapping marker standard. M-MATING++ 1-10%WT.
CB2619 C. elegans eDf1 eDp21/dpy-11(e224) V. Show Description
Heterozygotes are WT and segregate WT, Dpy and lethals which die in larval development. See also WBPaper00001202.
CB2777 C. elegans eDf11/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
CB3273 C. elegans lon-2(e678) mec-2(e75) X. Show Description
Long. Mechanosensory Abnormal. [NOTE: originally described as carrying e1084, this strain actually carries the e75 allele. The lesion has been verified by sequence analysis. (11/26/2018)]
CB3330 C. elegans che-11(e1810) V. Show Description
Defective in osmotic avoidance. FITC-. Dauer defective.
CB3440 C. elegans anc-1(e1873) I. Show Description
e1873 allele is the only anc-1 allele in which the molecular lesion has been identified (Starr and Han, 2002) and is considered by the authors to be the reference allele. e1873 does not revert, unlike most other alleles of anc-1. Reference: Hedgecock and Thomson. Cell. 1982 Aug;30(1):321-30. Starr and Han. Science. 2002 Oct 11;298(5592):406-9.
CB3610 C. elegans mig-6(e1931)/dpy-11(e224) V. Show Description
Heterozygotes are WT and segregate WT, Dpys, and steriles. mig-6(e1931) hermaphrodites are sterile, with failure of DTC migrations. Gonad sterile, disorganized, otherwise hermaphrodites appear normal. Strain is imperfectly balanced - check for correct segregation of Dpy and Mig from WT hermaphrodites.
CB384 C. elegans unc-11(ic9) unc-63(e384) I. Show Description
Unc. Recessive. Levamisole resistant. M-MATING++ 1-10%WT. Also contains an unc-11 mutation->Aixa Alfonso 10/94. See WBPaper00002195. Use ZZ37 for unc-63 reference strain.
CB3911 C. elegans dpy-27(rh18) III; 4A;3X. Show Description
Non-Dpy 4A;3X hermaphrodites segregating 4A;3X hermaphrodites, 4A;2X males and dead or very dumpy 4A;4X hermaphrodites. Reference: Strain 19 in Hodgkin (2002) PMID: 12399387
CB3991 C. elegans sma-8(e2111) V. Show Description
Short, blunt head. Dominant.
CB403 C. elegans unc-29(e403) I. Show Description
Unc. Recessive. M-MATING++ 1-10%WT. W176Stop, a "C" to "T" mutation at 3305 on the T08G11 cosmid.
CB4037 C. elegans glp-1(e2141) III. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. [2/98: Craig Mello noticed a different embryonic phenotype in this strain as compared to the e2141 stock that Jim Priess obtained from England-the ABp fate appears WT.] [NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2144) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in Worm Breeders Gazette December 2010; 18(3), e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.]
CB4111 C. elegans mab-24(e2169) I; him-5(e1490) V. Show Description
Anterior displacement of rays and fan. Ray identities are not altered. Slightly Unc (coiler).
CB4147 C. elegans fog-1(e2121) unc-11(e47) I; sDp2 (I;f). Show Description
Animals with the Dup are WT. Animals which have lost the Dup are Unc and female. Maintain by picking WT.
CB4281 C. elegans +/eT1 III; eDf43 dpy-11(e224)/eT1 V. Show Description
eDf43 pka lin-49(e2173). Heterozygotes are WT and segregate WT, Unc-36, and LinDpys. The lin-40 dpy-11 homozygotes are Dpy, Sterile and abnormal. Maintain by picking WT.
CB4457 C. elegans fem-1(e2342) / unc-5(e53) mor-2(e1125) IV. Show Description
Wild-type hermaphrodites segregating WT, Fem, Unc Mor. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.
CB4549 C. elegans dpy-11(e224) smg-4(ma116) V. Show Description
Dpy hermaphrodites. Protruding vulva in adult; viable at all temperatures.
CB4628 C. elegans tra-2(e1095) II; fem-1(e1927) IV; xol-1(y9) X. [XX females and tra-2; fem-1/+; xol-1 XX males] Show Description
Obligate male/female strain; maintain by crossing. Anatomically normal XX females and XX males. Male/female strain with sex determined by fem-1(+). Reference: Strain 11 in Hodgkin (2002) PMID: 12399387.
CB47 C. elegans unc-11(e47) I. Show Description
CB4711 C. elegans mab-5(e1239) egl-5(n945) III. Show Description
n945: HSN-. Egl. Coiler.
CB4760 C. elegans fem-1(e2044) mor-2(e1125) unc-24(e158) fem-3(q20) / unc-5(e53) dpy-20(e1282) IV Show Description
Wild-type hermaphrodites segregating wild-type hermaphrodites, Unc-24 females, Unc Dpy hermaphrodites. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.
CB4857 C. elegans C. elegans wild isolate. Show Description
Isolated from decaying mushroom during rain in Claremont, CA in November 1972. Wild type. Low copy Tc1, pattern II. Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. CB subclone of Cl2a (Tc1 pattern II). To obtain ECA249, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB5311 C. elegans egl-26(e1952e2650) II; him-8(e1489) IV. Show Description
Partial intragenic revertant. Weak Egl phenotype, less severe than egl-26(e1952). Reference: Hodgkin (1986) PMID: 3770465.
CB5337 C. elegans sma-8(e2656) V. Show Description
Small, blunt rounded nose; heterozygous e2656/+ are animals similar, XO males can mate. Molecularly and phenotypically different from sma-8(e2111).
CB5611 C. elegans bus-3(e2696) I. Show Description
Resistant to infection by Microbacterium nematophilum (no tail swelling).
CB611 C. elegans unc-23(e611) V. Show Description
Head abnormal. Variable expression. M-MATING+++ 10-30%WT.
CB6246 C. elegans sqt-3(e2911) V. Show Description
Slightly dumpy. Variable cold-sensitive lethal (poor viability at 15C). Unusual missense allele (D297G) of sqt-3, suppresses dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.
CB6667 C. elegans bus-12(e2977) IV. Show Description
Bus: resistant to M. nematophilum, Leucobacter Verde2; hypersensitive to Leucobacter Verde1. Strong nonsense mutation of bus-12 (Gln123Amber); reference null allele. Reference: Gravato-Nobre et al. (2011) PMID: 20980242.
CB6858 C. elegans srf-10(yj10) bus-12(e2997) IV. Show Description
Viable, surface abnormal, Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: Gravato-Nobre et al. (2011) PMID: 20980242.
CB791 C. elegans unc-5(e791) IV. Show Description
Superficially wild-type. References: Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Curr Biol. 2021 Apr 12;31(7):1508-1514.e5. doi: 10.1016/j.cub.2021.03.008. Epub 2021 Mar 18. PMID: 33740427. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
CER348 C. elegans trxr-1(cer35[Sec666C]) IV. Show Description
Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
CER374 C. elegans trxr-1(cer55[Sec666X]) IV. Show Description
Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
CF1514 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx211. Show Description
muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1660 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs84; muEx211. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]
CF2005 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs120. Show Description
muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2037 C. elegans muEx311. Show Description
muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. pep-2 is an other name for pept-1. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2248 C. elegans daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx158. Show Description
muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
CF2278 C. elegans daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx248. Show Description
muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.