| RA454 |
C. elegans |
swsn-1(tm4567)/rol-9(sc148) V. Show Description
Heterozygotes are mostly wild-type but occasionally lack a gonad arm; segregate tm4567 homozygotes (larval/embryonic lethal) and rol-9 homozygotes (Rol). Pick non-Rol to maintain and screen for larval lethals (or by PCR) for tm4567 deletion. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
|
|
| RA459 |
C. elegans |
ham-3(tm3309) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3309 homozygotes are maternal effect lethal (late embryo & larval lethal) and have gonadogenesis defects. Previously known as swsn-2.1(tm3309). Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
|
|
| RA491 |
C. elegans |
swsn-7(tm4263)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are wild-type GFP+ that segregate wild-type GFP+ heterozygotes, GFP- tm4263 homozygotes (MEL), and Dpy GFP+ mIn1 homozygotes. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
|
|
| RA520 |
C. elegans |
swsn-4(tm305) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are mostly wild-type GFP+, but occasionally have missing gonad arms. Pick wild-type GFP+ to maintain. Heterozygotes segregate wild-type GFP+, GFP- tm305 homozygotes (embryonic lethal) and arrested nT1 aneuploids. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
|
|
| RA521 |
C. elegans |
let-526(tm4795) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm4795 homozygotes. tm4795 homozygotes arrest as early larvae. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
|
|
| RG3344 |
C. elegans |
Y57G11C.1147(ve844[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve844 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ACGGACGACTCTTCCGGCAGTTGCAGACAT; Right flanking sequence: TCAACGCTGAAAAGCTGAAAAACGGTGAAG. Y57G11C.1147 sgRNA #1: GAGTATCTCCTTTGGTGACA; Y57G11C.1147 sgRNA #2: TCAGCGTTGAATGCACGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RW20022 |
C. briggsae |
Cbr-unc-119(stIs20000) III; stIs20022. Show Description
stIs20022 [Cbr-his-72::GFP::pie-1 3'UTR + Cbr-unc-119(+)]. C. briggsae with fluorescently labeled (GFP) histones. Reference: Zhou Z, et al. Genetics. 2010 Mar; 184(3): 853863. doi: 10.1534/genetics.109.110270 PMID: 20008572.
|
|
| RW20025 |
C. briggsae |
Cbr-unc-119(stIs20000) III; stIs20025. Show Description
stIs20025 [Cbr-his-72::mCherry::pie-1 3'UTR + Cbr-unc-119(+)]. C. briggsae with fluorescently labeled (mCherry) histones. Reference: Zhou Z, et al. Genetics. 2010 Mar; 184(3): 853863. doi: 10.1534/genetics.109.110270 PMID: 20008572.
|
|
| SHG2141 |
C. elegans |
nxf-1(ust372[nxf-1::mcherry]) V. Show Description
mCherry inserted into endogenous nxf-1locus using CRISPR/CAS9 engineering. Reference: Xu D, et al. Cell Rep. 2023 Aug 29;42(8):112915. doi: 10.1016/j.celrep.2023.112915. PMID: 37537842.
|
|
| SLR246 |
C. elegans |
unc-119(ed3) III; stxEx39. Show Description
stxEx39 [alx-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of alx-1 coding sequence in fosmid WRM064D_F05 by recombineering (TransgeneOme bacterial clone 095794875301489 F02). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
|
|
| SLR247 |
C. elegans |
unc-119(ed3) III; stxEx48. Show Description
stxEx48 [C01A2.4::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of C01A2.4 coding sequence in fosmid WRM061C_F01 by recombineering (TransgeneOme bacterial clone 7225558184899882 D12). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
|
|
| SLR248 |
C. elegans |
unc-119(ed3) III; stxEx35. Show Description
stxEx35 [istr-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of istr-1 coding sequence in fosmid WRM0636D_F01 by recombineering (TransgeneOme bacterial clone 5438954842362824 D10). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
|
|
| SWF117 |
C elegans |
flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF142 |
C elegans |
mod-1(ok103) V; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF150 |
C elegans |
ser-5(tm2647) I; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF154 |
C elegans |
ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF155 |
C elegans |
ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF193 |
C. elegans |
ser-4(flv7) III; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF302 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF380 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF409 |
C. elegans |
lgc-50(syb3560[lgc-50::T2A::mNeonGreen]) III. Show Description
Endogenous lgc-50 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406
to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF415 |
C elegans |
lite-1(ce314) gur-3(ok2245) X; flvIs17; flvIs18. Show Description
flvIs17 [tag-168::NLS::GCaMP7F + gcy-28.d::NLS::tagRFPt + ceh-36::NLS::tagRFPt + inx-1::tagRFPt + mod-1::tagRFPt + tph-1(short)::NLS::tagRFPt + gcy-5::NLS-;:tagRFPt + gcy-7::NLS::tagRFPt]. flvIs18 [tag-168::NLS::mNeptune2.5]. This strain can be used for calcium imaging at whole-brain level. Back-crossed 5x to MT21793 after transgene integration. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF420 |
C elegans |
ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF424 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF469 |
C elegans |
ser-5(tm2647) I; lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF800 |
C elegans |
ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF912 |
C elegans |
lgc-50(flv8) III; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| TG3867 |
C. elegans |
xpg-1(tm1670) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306
|
|
| TP193 |
C. elegans |
rips-1(ij109) V. Show Description
Resistance to strong reducing conditions: dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095
|
|
| TP390 |
C. elegans |
mce-1(ok243) I; rips-1(ij109) V. Show Description
mce-1(D2030.5). Strong resistance to reducing agents dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095
|
|
| TV16821 |
C. elegans |
wyIs592 III; hpo-30(ok2047) V. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. Defects in PVD dendrite morphology. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV17248 |
C. elegans |
wyIs592 III; sax-7(nj48) IV. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. nj48 is a punitive null allele of sax-7. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV17268 |
C. elegans |
kpc-1(xr58) I; wyIs592 III. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV17465 |
C. elegans |
dma-1(wy908) I; wyIs592 III. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. dma-1(wy908) is a partial loss of function allele generated by CRISPR/Cas9-induced frame shift with multiple premature stop codons (n=6, 8 bp deletion). Fluorescent PVD- and FLP-specific morphology markers. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV24410 |
C. elegans |
wyIs592 III; hpo-30(wy1220) V. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV24913 |
C. elegans |
dma-1(wy1246[dma-1::GFP]) I. Show Description
GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV25655 |
C. elegans |
wyIs738 I; wyIs592 III; hpo-30(wy1220) V. Show Description
wyIs738 [ser-2(prom3)::dma-1:GFP + odr-1p::GFP] I. wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV26091 |
C. elegans |
dma-1(wy1437[*wy1246]) I . Show Description
GFP tag inserted into endogenous dma-1 locus with a CRISPR/Cas9-engineered dma-1(C470Y) substitution mutation. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV27036 |
C. elegans |
dma-1(wy1246[dma-1::GFP]) kpc-1(gk8) I; wyIs581 IV. Show Description
wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV27065 |
C. elegans |
rab-10(wy1298[GFP::FLPon(FRT)::rab-10]) I; wyIs581 IV; wyIs910 X. Show Description
wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. GFP::FLPon(FRT) tag inserted into endogenous rab-10 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV27863 |
C. elegans |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) I; hpo-30(wy1220) V; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV27864 |
C. elegans |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) I; hpo-30(ok2047) V; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::flippase + unc-122::BFP]. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. ok2047 is a 1294 bp deletion in hpo-30. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV27873 |
C. elegans |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) kpc-1(gk8) I; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV27876 |
C. elegans |
rab-10(wy1616[mScarlet::rab-10]) dma-1(wy1246[dma-1::GFP]) I; sax-7(nj48) IV; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV29097 |
C. elegans |
dma-1(wy1924) I; wySi919 V. Show Description
wySi919 [des-2p::myr-mScarlet::let-858 3'UTR] V. dma-1(wy1924) is a deletion allele removing LRR. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| TV29856 |
C. elegans |
kpc-1(gk8) I; wyIs592 III. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. gk8 is a punitive null allele of kpc-1. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
|
|
| UT1306 |
C. elegans |
akt-1(mm200) V. Show Description
Benzaldehyde/starvation learning defective. mm200 is a single base pair change resulting in an L199F substitution. Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
|
|
| UT1343 |
C. elegans |
crh-2(gk3293) II; crh-1(tz2) III. Show Description
Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
|
|
| UTX113 |
C. elegans |
par-3(djd33[mScarlet-I-GLO::Myc::par-3]) III. Show Description
mScarlet-I-GLO and Myc tags inserted into endogenous par-3 locus. mScarlet-I-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Chang Y & Dickinson DJ. Cell Rep. 2022 Apr 12;39(2):110652. doi: 10.1016/j.celrep.2022.110652. PMID: 35417695.
|
|
| VC239 |
C. elegans |
sams-5(gk147) IV. Show Description
T13A10.11a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|