zzyIs31 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.5 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs34 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 2.37 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs37 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 15.35 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs43 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs49 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs64 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 9.74 and 21.54 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)] II. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. The membrane-specific PH(PLC1delta1) domain, labeled with mCherry, is expressed in all cell membranes. Derived by crossing parental strains carrying unc-119(ed3) and unc-119(tm4063). Unknown if either unc-119 mutation is still present in background. Reference: Cao J, et al. Nat Commun. 2020 Dec 7;11(1):6254. doi: 10.1038/s41467-020-19863-x. PMID: 33288755.

zzyIs66 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 7.75 and 17.07 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

asEx98 [spe-21(+) + myo-3::GFP]. Pick GFP+ animals to maintain. syb(4299) is a non-conditional allele of spe-21. Mutant hermaphrodites and males are severly subfertile. Array carries a fragment (PCR product) of R13F6.5 containing a wild-type copy spe-21(+). spe-21/R13F6.5 formerly known as dhhc-5. The extrachromosomal array effectively rescues the fertility defect. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.

mNeonGreen tag inserted at the C-terminus of the endogenous spe-21 locus by CRISPR. Expression in the membranous organelles of sperm. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.

aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772.

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144

olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Paralyzed Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144

olaEx3013 [ttx-3p::mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Slow moving. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144

wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.

wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc- 47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.

wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.

wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.

wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA, and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.

wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.

V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.

282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.

Inactive RNase mutation of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.

GFP tag inserted at N-terminus of endogenous cosa-1 locus. Expressed primarily in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.

The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544. doi: 10.1016/j.celrep.2023.112544. PMID: 37227820. .

viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.

zcIs4 [hsp-4::GFP] V. vit-1(ac2) is a dominant allele that causes ER stress. Since vit-1 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-4(ac4) is a dominant allele that causes ER stress. Since vit-4 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-5(ac5) is a dominant allele that causes ER stress. Since vit-5 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-6(ac6) is a dominant allele that causes ER stress. Since vit-6 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

acIs156 [vit-2p::vit-2(G839R)::GFP + myo-2p::mCherry]. In contrast to VIT-2::GFP, VIT-2(G839R)::GFP remains in the intestine and is not transported to embryos. mCherry expression in pharynx. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

ynIs78 [flp-8p::GFP]. acEx178 [flp-8p::ced-3 (p15)::nz + flp-32::cz::ced-3 (p17) + unc-122p::RFP]. AUA interneurons ablated in flp-8p::GFP background. GFP-labelled AUA neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.

ynIs78 [flp-8p::GFP]. acEx179 [flp-21p::ced-3 (p15)::nz + ncs-1p::cz::ced-3 (p17) + unc-122p::RFP]. RMG interneurons ablated in flp-21p::GFP background. GFP-labelled RMG neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.

sEx11108 [rCes C28H8.11b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14878 [rCesT13A10.11a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15515 [rCesT13A10.11b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1027 [unc-122p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in coelomocytes and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in coelomocytes can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous npp-2 inserted by CRISPR/Cas9 after the npp-2 start codon. FRT sites in GFP introns 2 & 3. Ubiquitous expression of mCh::HIS-58. Might carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Can be used for inducible degradation of GFP fusion proteins in hypodermal cell. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi1030 [hsp16.41p::FRT::mCherry::his-58::FRT::vhhGFP4::zif-1 + unc-119(+)] II. bqSi508 [elt-2p::FLP + unc-119(+)] IV. Can be used for inducible degradation of GFP fusion proteins in intestinal cells. May carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1201 [hlh-12p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the distal tip cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous baf-1 inserted by CRISPR/Cas9 after the baf-1 start codon. FRT sites in GFP intron 3 and baf-1 3'UTR are indicated by ">" symbols in genotype. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1308 [hlh-12p::FLP::SL2::mTagBFP2 + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mTagBFP2 in the distal tip cells. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

mCherry tag inserted into endogenous baf-1 locus after the start codon using by CRISPR/Cas9 engineering. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the mel-28 start codon. FRT sites in GFP introns 2 & 3. Ubiquitous expression of mCherry::HIS-58. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi852 [ckb-3p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the somatic gonad and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the somatic gonad can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632