More Fields
Strain Species Genotype
VC2391 C. elegans gkDf17 II; gkDf18 C50C10.2(gk3035) gcy-20(gk1184) V. Show Description
C40A11.7, C40A11.8, C40A11.1, F56E10.1, Y38C9A.1, C50C10.2, F21H7.9. The allele gk1184 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 2042 bp. Deletion left flank: ACCGCAATTAATTCCAATTCTAAGGTTTAT. Deletion right flank: ACTGGCGTCTTACAGTAAATTTTGTGTGAC. The allele gkDf17 was identified by CGH but not confirmed by PCR. Left flanking probe: ATTCCGCGATGTCTCCTTAAATCTTTTGGCAGAGGTTCTCGATTATCCAT. Right flanking probe: ATTGATCGAAAGTTACGAAGACGTGGACTAGTCCCAAAATTCCTAGTGAC. Left deleted probe: GAAAATAGATTTCTACCACTGAACTGTTTTTCTTAACAAACTCATCGAAT. Right deleted probe: CTGTTGAGAACATATCTAGTATTAAGGAAGGAGGGAACTATTCCACAGGC. The allele gkDf18 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAATTTTCGAGGAAGATGAAGTTTATGCGGACGTCCAAAGTGTTGAAAA. Right flanking probe: GATTTCGCTGTGATAAGCGTCGAGGAGGCAATCGAAATGTGGAGCTTCTG. Left deleted probe: CCAAAGTGTTGAAAAACGGAAAATTCAGGATTTCGACGAGCGAATTGAGG. Right deleted probe: CAATTATGCAAATCTCGTCGATATTATACAAAATGATATAGATTTCGCTG. The allele gk3035 was identified by CGH but not confirmed by PCR. Left flanking probe: TGTTTCAGTATTGCCGTCTTATTATGTATAGATTTGCTATTCCATTTCTA. Right flanking probe: CATTTTCGAGTTCAATTTTCTGTGCAAACGCTGGAATGACAATATTCATG. Left deleted probe: TTTATCGTCCCATTAGCATTGTCACTTTTCAATGTTACTACAGTAGGATT. Right deleted probe: TTGTACGAAGGAGAGGAATATGCAAAGTTGAATGCTATTATTCATCTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2411 C. elegans Y48G1A.4(ok3096) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y48G1A.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3096 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAAACTCGCAAAAATTCGCA. External right primer: TCAAATTGCACAAATTCCGA. Internal left primer: TGAAGTGTTTGCGTACAGCG. Internal right primer: TTTTTGGGTTTTAGGTTTTCCA. Internal WT amplicon: 1221 bp. Deletion size: 520 bp. Deletion left flank: TGCGCACGACTTGACGCGCAAACTTCCCAA. Deletion right flank: GGAAAAGCGCTCTCGGACATTGAAAAATAC. Insertion Sequence: CAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2415 C. elegans mtx-1(ok3155) I. Show Description
F39B2.11. External left primer: GATTTTGTCGTCTCGTGGGT. External right primer: CAGGATAGCAATTGGGGAGA. Internal left primer: AGTAGGTAGGGGGCAAGCAA. Internal right primer: CTTTGTTCGAAATTTTCCGC. Internal WT amplicon: 1278 bp. Deletion size: 371 bp. Deletion left flank: TCTTACCACTGCTGGATACAAATTGTGATG. Deletion right flank: CTTGAAATTCCAAATTCGGAAAAAAATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2424 C. elegans B0336.11(gk1130) T03F6.4(gk3213) III. Show Description
This strain is homozygous for a deletion (gk1130) in B0336.11, detectable by PCR using the following primers. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 416 bp. Deletion left flank: TAATAAACTTCATTGCGTCAAAGCTCTGAA. Deletion right flank: CATAATTGCATATGCAATATCTACATCGTA. Validation: gk1130 passed by CGH. Other deletion (gk3213) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2450 C. elegans gcy-17(gk1155) I. Show Description
W03F11.2. External left primer: TCTAGGTCAAAAGCGGAGGA. External right primer: CTTTAACACGGTGAAGGGGA. Internal left primer: GGAAATGGAGCATCGAGGTA. Internal right primer: CATATGCAAGATGTTTGCCG. Internal WT amplicon: 1241 bp. Deletion size: 655 bp. Deletion left flank: GCATTGAGCTTCTGCTAATGACATCGGCCA. Deletion right flank: TAAATTTTGAGAGTAAAGTTCTTACATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2455 C. elegans B0336.11(gk1109) III. Show Description
B0336.11. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 425 bp. Deletion left flank: TTCTGCTTTTCGGTCCGCGACTTGATCTTC. Deletion right flank: AAGAGTAGAAACAGCCGGGGAGCGCTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2457 C. elegans ctn-1(gk3037) eri-6&C41D11.6(gk3038) I; gcy-20(gk1227) V. Show Description
Y23H5A.5, C41D11.1, C41D11.6, F21H7.9. The allele gk1227 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 367 bp. Deletion left flank: GCTACCACGGAACCTGAATTAGAAATTTCT. Deletion right flank: TATAAATCGTTTAAAAGAGTGACCACTTGC. Insertion Sequence: C. The allele gk3037 was identified by CGH but not confirmed by PCR. Left flanking probe: TCAATTTTGCCCGATCATATGAAGTTTGCAGTTTGCAACCTGTAGTTTGT. Right flanking probe: GAGAACTTGGAGGTGTTCTGTGACACCTGGGGGCAGGCGGTGAGTTATTG. Left deleted probe: AATGTTAGAATCAGCGTGGTCCAGCCTCGTTAGGTAGTCTCTCCGCCGCC. Right deleted probe: GTGCACCCATCTTCGAGGATAGCCAGGGAGAACTTGGAGGTGTTCTGTGA. The allele gk3038 was identified by CGH but not confirmed by PCR. Left flanking probe: AGATGAAGAAATGGGTAGGCTTTCCTTGCTCCCATGATTCCGAAGTTGAT. Right flanking probe: TTTTTAGGCGTTGTCGAGGCCGTAGCCGCCAAAAACGTTAGGCCGCGCAT. Left deleted probe: GATGACTTGTGGACGAAGATCCCATGACTTACTTTGAGCTGCAGTTTCTC. Right deleted probe: GTAAAATCAAATACGCGGAAGTATGTATACCCTTGCCTACTCTAGAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2461 C. elegans Y22D7AL.7(gk3210) III; R11E3.2(gk3211) ZK616.3(gk3212) IV; F39F10.2(gk1161) X. Show Description
This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2472 C. elegans clc-14(ok2825) I. Show Description
F59C6.11. External left primer: TGTCGATTATTGTGCGCCTA. External right primer: GTTTCGAAGGTCTTGCTGGA. Internal left primer: TGAGGATTCGTCAATAAGAAAAA. Internal right primer: CGAAAAAGTCAATGTTTTGGG. Internal WT amplicon: 1148 bp. Deletion size: 575 bp. Deletion left flank: TGGACATCAGGGAATCACTGGTATAAATTG. Deletion right flank: AGTGGCAAGTTTTATTCTGGTCTTTTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2474 C. elegans nhr-178(gk1158) V. Show Description
F16B4.9. Identified by PCR, validated by CGH. External left primer: ACATCCATCTTTCTGGCGAC. External right primer: TTCGGAGTCACAAGTTGCAG. Internal left primer: GCGCACCCTGAACATAGTTT. Internal right primer: AAATATGGGAGCAGCGTTTG. Internal WT amplicon: 1511 bp. Deletion size: 502 bp. Deletion left flank: ATCTAAAATCGCGCTTTTGATTTTGTTCTG. Deletion right flank: ATATAAACGACTATATTTGCATTGAATTCA. Insertion Sequence: TAAACGACTATATTTGCATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2490 C. elegans W07E11.1&flp-2(gk1039) X. Show Description
W07E11.3, W07E11.1. External left primer: GGGCGGGTTTCTAAAAAGTAAGTG. External right primer: TCGGTGTCTGGCTCAAGCATG. Internal left primer: GTTAACGGAAGAGGTGGGATC. Internal right primer: GGGCATCTCAACGACATGACG. Internal WT amplicon: 2724 bp. Deletion size: 2618 bp. Deletion left flank: ACGGAAGAGGTGGGATCTCTCGAAAAACCT. Deletion right flank: GTAGAGTGAACACAGATTGAGCACTTGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2497 C. elegans flp-3(ok3265) X. Show Description
W07E11.2. External left primer: CAGTTTCCACGCATTCATTG. External right primer: ATATCTCGGCGGTTCACAAC. Internal left primer: GAGCGAACCATGAAATTGTG. Internal right primer: GCGTAACACCACCATAACCA. Internal WT amplicon: 1113 bp. Deletion size: 457 bp. Deletion left flank: TTCTTTTGCCAAAGCGCATTGTGCCAAATG. Deletion right flank: TCATTTCATCAGCAATGGCTCGTTTGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2498 C. elegans B0336.11(gk1147) III. Show Description
B0336.11. Identified by PCR, validated by CGH. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 379 bp. Deletion left flank: CTTAAACAAAAACACCTACTTTCCATGAAG. Deletion right flank: ATACATCAGTTGGTTATCTAGTAATGGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2511 C. elegans Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2536 C. elegans W02B12.11(ok3260) II. Show Description
W02B12.11. External left primer: AAAAGACCGGACAACCACTG. External right primer: AACCTACATCAACTTCGGCG. Internal left primer: CAGCCGGATTTCTTTTCTGA. Internal right primer: CCGTTTCCTCTTCACATGCT. Internal WT amplicon: 1242 bp. Deletion size: 481 bp. Deletion left flank: ATTTACAGCCGGATTTCTTTTCTGATCCCC. Deletion right flank: CAGCGCCGAAGAGGACGGATCTTGTCCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2538 C. elegans C08B11.3(gk1041)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C08B11.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1041 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCTCGATCGACACTTCGCT. External right primer: TAACATATCGACGTTGGGCA. Internal left primer: ACGGCTCGTCTGTTCTGATT. Internal right primer: AATTGACGGATCCACCTGAG. Internal WT amplicon: 2394 bp. Deletion size: 561 bp. Deletion left flank: GATCAATCTGAAATTCATTTTTCAAATTAT. Deletion right flank: TGCAAAATCGATTTCGTTCGGCAATCCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2539 C. elegans noah-2(ok3197) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3197 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCTTAGGCACAGACGTAGG. External right primer: CACTGAGAGCGAGACGACTG. Internal left primer: GCACTGCTTCTTCCTGCTTC. Internal right primer: CAGAGAAGCTCGGTGGAGTC. Internal WT amplicon: 1129 bp. Deletion size: 806 bp. Deletion left flank: TGAATCCCAATTCGGAGGAATGGCTCTCTG. Deletion right flank: AGGAGAAGCTTTCGGCTATCATTCGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2541 C. elegans K02E11.10(ok3266) V/nT1 [qIs51] (IV;V). Show Description
K02E11.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3266 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCAACTTGTCCTTGTTGGG. External right primer: GGAGTGTGCAGCAAATTTCA. Internal left primer: CTTCGAAGCCTCCTTGAGTA. Internal right primer: GCGTCTTGAGGCCATAGTTC. Internal WT amplicon: 1208 bp. Deletion size: 582 bp. Deletion left flank: CCTGAGCAGGCCCTTGCTGATATCCGGCTC. Deletion right flank: GGCAGGCTAAGATCACAACGGATTTCATCT. Insertion Sequence: TTCCCTGAACTCCTTGAGCAGATCCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2575 C. elegans Y75B8A.11(ok3346) III. Show Description
Y75B8A.11. External left primer: AATGCCCAGCATTCTTCAAA. External right primer: TTGCCAGAGGAAAGCTCACT. Internal left primer: GCATGCACCTCAAAGAAAAA. Internal right primer: CGATGCTATTCGTGACCTGA. Internal WT amplicon: 1334 bp. Deletion size: 682 bp. Deletion left flank: CCACCAGCACCATAAACCATCAAAAGCTTG. Deletion right flank: GGCTGGGACTTTTTTGGTTTTTTTTTGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2582 C. elegans B0035.11(gk1081) IV/nT1 [qIs51] (IV;V). Show Description
B0035.11. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: TTCGGACATAGTGGTTCCGT. External right primer: TTACGTTCCCCAGTGTCTCC. Internal left primer: AGCGAGGAAGACGTAGTGGA. Internal right primer: TGCACCAGGAACACCAGTTA. Internal WT amplicon: 1795 bp. Deletion size: 710 bp. Deletion left flank: GGAAGGTCATACGATGTGTAAGAACAGCTT. Deletion right flank: CTTTCGGCTTTCCTTCTCTGTCGGAATCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC259 C. elegans pak-2(ok332) V. Show Description
C45B11.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2591 C. elegans flp-2(ok3351) X. Show Description
W07E11.3. External left primer: TCAACTCTCACACAGCCCAC. External right primer: ATTTTCAGGTACACACCCGC. Internal left primer: GTTGGTTGAGATGCCACCTT. Internal right primer: CACAGAGCTTTCGTCTGACTC. Internal WT amplicon: 1219 bp. Deletion size: 372 bp. Deletion left flank: TTCCAAATATGTGTTTGGGTTTTAAGCTTG. Deletion right flank: CGACAATTGGTTTGGCAACGACTGACAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2594 C. elegans F20H11.1(ok3386) III. Show Description
F20H11.1. External left primer: CAGCAACTCCATCAAAGCAA. External right primer: CGTTTCTGCCGATTTTTCAT. Internal left primer: AGTTGACAGAACTCCGGCAC. Internal right primer: TTTTGGCTAGAGAATCACAAAAA. Internal WT amplicon: 1279 bp. Deletion size: 472 bp. Deletion left flank: GTGCAAAAAAAACAATTTCTCCAGACCGGG. Deletion right flank: AAGGAGTTGAAGATTGATTATGAGCATCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2611 C. elegans C29F7.1(ok3434) X. Show Description
C29F7.1. External left primer: CAAAGCTGGGTGAAGGTGTT. External right primer: CATAAGATTGGCATCTCGCA. Internal left primer: GATGTTAACAAAGGCAACGC. Internal right primer: AGGTTTTCCATCGGTCTGAA. Internal WT amplicon: 1264 bp. Deletion size: 309 bp. Deletion left flank: AAAAAGTTTTTTTAGAACTTTTTTATTTAG. Deletion right flank: AAGTCCCATGGAAGATCTCCATAGAATTTT. Insertion Sequence: TTGGTCATCAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2621 C. elegans tns-1(ok80) I. Show Description
M01E11.7. External left primer: GGTTGCTCAGGTTCAAGCTC. External right primer: TGAAATTGTTGGCGTGTGTT. Internal left primer: AACACCTTCCGCGTGTTATC. Internal right primer: CGTCCGTGATTCGAACTCTT. Internal WT amplicon: 2173 bp. Deletion size: 1514 bp. Deletion left flank: TCAAGTGGTACGTGATTGGATTTTGTACTA. Deletion right flank: CCATATGGTTTCCCTAAACTCACCTCATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2626 C. elegans F46G11.1(ok3198) X. Show Description
F46G11.1. External left primer: CCTTCTCCAAGACTTGACGC. External right primer: TACCCAGCGTATTGCACAAG. Internal left primer: TTTCCGTTTTCAGCGCTACT. Internal right primer: TCTCGAAACTGCAGAACAGC. Internal WT amplicon: 1253 bp. Deletion size: 849 bp. Deletion left flank: GTAAGTAGAAATTCCGATGTCTTCCTTCAT. Deletion right flank: TTTAAATTTTAGCATTAGCTGAGTTTTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2627 C. elegans F54F11.2(ok3251) III. Show Description
F54F11.2. External left primer: AGTGGTACTGTAGGCCGGTG. External right primer: TCGGAGATCATAGGGCATTC. Internal left primer: TCCTACGCCTGTGGAAACTT. Internal right primer: TTGCATAGGCCTTCTGCTTT. Internal WT amplicon: 1216 bp. Deletion size: 472 bp. Deletion left flank: AGGATCCAACTTACCAGACCACTATCAATA. Deletion right flank: CTATGAGCAGAACATTGCAGTCAAGTACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2654 C. elegans ubl-5(ok3389) I. Show Description
F46F11.4. External left primer: GGAGCGAAGAAAGAGGGAGT. External right primer: GTGCATGCGCCTTTAAGTTT. Internal left primer: GCAGAAATTAATGGGGTGGA. Internal right primer: GCGTCGAGTTGTGTGTTTTT. Internal WT amplicon: 1248 bp. Deletion size: 294 bp. Deletion left flank: TTTTTTTTTATTAAACAATAAAAAATGTAT. Deletion right flank: TCAAATTTTCAATTTGTTTCTAATATATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2674 C. elegans plk-3(gk1103) IV. Show Description
F55G1.8. External left primer: ACGTCACACGATCTGCACTC. External right primer: ACCGCCAATTATCTACGACG. Internal left primer: TGTTTCTGATATCGTGGCGA. Internal right primer: TACACAATCCAAGTTGCCGA. Internal WT amplicon: 2311 bp. Deletion size: 1122 bp. Deletion left flank: TAAAGATCGAATTATTCACAGATTAGTTGT. Deletion right flank: ATATGTTGGCTCAATCGTAGTCTTGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC269 C. elegans sqv-3&vha-1(ok513)/eT1 III; +/eT1 V. Show Description
R10E11.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok513 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2698 C. elegans F33D11.7(gk1229) I. Show Description
F33D11.7. Identified by PCR, validated by CGH. External left primer: TTGGCTGCCTACTCTCCACT. External right primer: TTTACGTGTTCGGCCTTGAT. Internal left primer: GACCATTTCGGCACAACTTT. Internal right primer: ATACGATCTACGTGGCGGAG. Internal WT amplicon: 1225 bp. Deletion size: 945 bp. Deletion left flank: CACGTTGGAGCAACATGCACAAGACACTGA. Deletion right flank: TGTTACAGAAATATTGATACTTATACATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2754 C. elegans hsp-60(ok3508)/sC1 [dpy-1(s2170)] III. Show Description
Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2802 C. elegans K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V. Show Description
This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC281 C. elegans hsp-12.6(gk156) IV. Show Description
F38E11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2839 C. elegans T05H4.11&atp-4(ok2678) V/nT1 [qIs51] (IV;V). Show Description
T05H4.11. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2678 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTTTGAAGCTCGACGTG. External right primer: CGTAATGGCCTCATTCGTTT. Internal left primer: ATTCGAATGGAACCGAGTCA. Internal right primer: TTTCCCGTTTGTAACCTCCA. Internal WT amplicon: 2683 bp. Deletion size: 1414 bp. Deletion left flank: TTGTGTTTCAAATCGGACACTCTGCAAAAT. Deletion right flank: CCTTAGCAGCTTCAAAGTTAGTTGGGAGCT. Insertion Sequence: TCGTTTATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC284 C. elegans nab-1(gk164) I. Show Description
C43E11.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2857 C. elegans F45H11.6(gk1216) I; F09A5.2(gk3060) X. Show Description
F45H11.6, F09A5.2. The allele gk1216 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 646 bp. Deletion left flank: GATGAAGAATGAGAAAGGAAATATTTGAAG. Deletion right flank: AATAATGTTGTCTGGTACAGGTATCAAATC. The allele gk3060 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right flanking probe: TGGTGAGTGACCTTTCCATAAACCGAATTACCTCGGAAAATGTTTTTAGA. Left deleted probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right deleted probe: GAGAAGACATAAAGATTATGTGCTGATGGTGAGTGACCTTTCCATAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2876 C. elegans egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2916 C. elegans F45H11.6(gk1242) I. Show Description
F45H11.6. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 572 bp. Deletion left flank: GAAATATTTGAAGTAAAAATAATAATACAT. Deletion right flank: TTGAATGCCAGTTTTAAGGCACACACTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2919 C. elegans clec-198(gk3149) IV; W03G11.3(gk1251) X. Show Description
C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2948 C. elegans frm-2(ok3690) III. Show Description
frm-2. Homozygous viable deletion, detectable by nested PCR. External left primer: AGAGGGGAATATCCCGATTG. External right primer: AGAACAATGGCCAAATCCAG. Internal left primer: GTTGCATTGGGGGAACAATA. Internal right primer: CGTTCGTTTTTCACTTGACG. Internal WT amplicon: 1105 bp. Deletion size: 411 bp. Deletion left flank: CCTGGAAAGTTTATGGAGTATTTGAAAACA. Deletion right flank: ATTTTGCATGGGTTCGCTGTTGATCATTGG. Insertion sequence at break: AAAACCTTGTATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2953 C. elegans C46H11.3(ok3704) I. Show Description
C46H11.3. Homozygous viable deletion, detectable by nested PCR. External left primer: AATTTTACACCCCCTCCAGC. External right primer: GGAGTCTCCGATTGTCCAAA. Internal left primer: GTCCTTGTTTTTGTTGGTTTTT. Internal right primer: AGCTCAATGCCCACTCACTT. Internal WT amplicon: 1318 bp. Deletion size: 391 bp. Deletion left flank: AATTTTTGAATAAATAATAATATTTCAATA. Deletion right flank: CAGGGATCCATTGTTCGAGTGTTGTCCAAT. Insertion sequence at break: GGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2975 C. elegans bath-5(gk3138) II; Y41D4B.26(gk1259) IV; unc-83(gk3139) V. Show Description
W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2982 C. elegans gkDf24 I; ikke-1(gk1264) III. Show Description
F11A6.1, W04G5.6, T22H2.1, T22H2.6, F11A6.2, T22H2.5, T22H2.3, R107.4, T22H2.2, W04G5.5, W04G5.10, W04G5.1, W04G5.15, W04G5.9, W04G5.12, W04G5.13, W04G5.11, W04G5.8, W04G5.7, W04G5.14, F11A6.8, F11A6.11, F11A6.5, F11A6.9, F11A6.13, F11A6.4, F11A6.10, F11A6.14, F11A6.6, F11A6.7, F11A6.12, T22H2.4, T22H2.7. The gk1264 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ATTCTCGCAACAAATCCGAC. External right primer: CAATCGTCATTACACACGGC. Internal left primer: GCTCCGGTTTAGGGAATTGT. Internal right primer: AGTAGCAGTTTGGAAGCGGA. Internal WT amplicon: 2692 bp. Deletion size: 722 bp. Deletion left flank: TGAAGGTTCATGGAAAAAGCTGCGTAGAAG. Deletion right flank: TGCATTTGATGAAAGTCCTCTGTGATTCTT. The gkDf24 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC30011 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC3011 C. elegans gkDf21 I; Y53F4B.1(gk1289) II. Show Description
This strain is homozygous for a deletion (gk1289) in Y53F4B.1, detectable by PCR using the following primers. External left primer: GCACTTCAAACGCAGATTCA. External right primer: GTTGTGGCTGCTCTGAACAA. Internal left primer: GCTGCTGACGTCACACTGAT. Internal right primer: TATTGGTGAAAGAGAGGCCG. Internal WT amplicon: 2011 bp. Deletion size: 862 bp. Deletion left flank: AATAGAAGGTAGGCAGGCACGTAGGCAGCG. Deletion right flank: AATTTGCCGTTTGCCAGAAATGTTTTTTTT. Validation: gk1289 passed by CGH. Other deletion (gkDf21) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC30111 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC30130 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Note that this strain is known to segregate homozygous unc-22 and strong Dumpy progeny (gene not identified). The strain was validated by PCR and sequencing of the allele gk421264 in D2030.11. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC30211 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC3032 C. elegans nas-11(ok3723) X. Show Description
K11G12.1. External left primer: AAAACACAGGCACCTTGGTC. External right primer: TCTGATTGGGGAACTTGGAT. Internal left primer: CAAAGAATGGAAAGGCAAAG. Internal right primer: ACTAGGATGAGATGGGCAGC. Internal WT amplicon: 1336 bp. Deletion size: 982 bp. Deletion left flank: TCATGTAAGCTCGGAACATGTGAACAAACT. Deletion right flank: AAAACGGGCAGAATTGTAGATTTGCTGCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807