DLM26 |
C. elegans |
hif-1(ia4) V; otEx3165. Show Description
otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
DLW109 |
C. elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DLW110 |
C. elegans |
wrdSi23 I; unc-18(knu969[unc-18::AID]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DLW112 |
C. elegans |
reSi7 I; unc-104(knu973[unc-104::AID]) II. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DLW114 |
C. elegans |
reSi7 I; unc-18(knu969[unc-18::AID]) X. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DQM583 |
C. elegans |
bmdSi141 I. Show Description
bmdSi141 [loxN::eft-3p::his-58::GFP] I. Slow growing. Maintain at 15-20C. bmdSi141 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069
|
|
DQM594 |
C. elegans |
bmdSi170 I. Show Description
bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069
|
|
DV3313 |
C. elegans |
rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
|
|
EG9747 |
C. elegans |
oxSi1106 II; unc-119(ed3) III. Show Description
oxSi1106 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + lox2272] II. Integrated Cas9 transgene inserted into ttTi5605 MosSci site. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9876 |
C. elegans |
unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9881 |
C. elegans |
unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9882 |
C. elegans |
F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9885 |
C. elegans |
W01A8.6(oxTi1120) I; unc-119(ox819) III. Show Description
oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9887 |
C. elegans |
W01A8.6(oxTi1128) I; unc-119(ox819) III. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9888 |
C. elegans |
W01A8.6(oxTi1128) I. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
FAS32 |
C. elegans |
his-74(uge16[gfp::his-74]) V. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
FAS34 |
C. elegans |
his-74(uge18) V. Show Description
Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
FAS43 |
C. elegans |
his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
FAS45 |
C. elegans |
hira-1(uge29) III. Show Description
Null mutant of hira-1. Temperature-sensitive. Can be maintained at 20C. Developmental defects include protruding vulva and reduced brood size at 20C; nearly sterile at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
FAS46 |
C. elegans |
his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
FAS47 |
C. elegans |
his-70(uge31[gfp::his-70]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
FAS65 |
C. elegans |
his-69&his-70(uge44) III. Show Description
Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
FAS84 |
C. elegans |
his-71(uge45[gfp::his-71]) X. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
HA2845 |
C.elegans |
fust-1(rt255]) II. Show Description
Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
|
|
HA2846 |
C.elegans |
fust-1(rt256[R446S]) II. Show Description
fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
|
|
HA2847 |
C.elegans |
fust-1(rt257[P447L]) II. Show Description
fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
|
|
HA2987 |
C. elegans |
sod-1(rt449[G85RC]) II. Show Description
sod-1(rt449[G85RC]) was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation G93A. This strain also contains additional silent edits, and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2987 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
|
|
HC726 |
C. elegans |
sid-1(qt95) V. Show Description
Sid. Hypomorhic allele. Reference: Whangbo JS, et al. G3 (Bethesda). 2017 Oct 12 [Epub ahead of print]. pii: g3.300308.2017. doi: 10.1534/g3.117.300308. PMID: 29025917.
|
|
HC970 |
C. elegans |
sid-1(qt78) V. Show Description
Sid. Deletion allele. Reference: Whangbo JS, et al. G3 (Bethesda). 2017 Oct 12 [Epub ahead of print]. pii: g3.300308.2017. doi: 10.1534/g3.117.300308. PMID: 29025917.
|
|
JEL1197 |
C. elegans |
wrdSi3 II; dpy-27(xoe41[dpy-27::AID::myc]) III; him-8(me4) IV. Show Description
wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.
|
|
JEL446 |
C. briggsae |
Cbr-met-2(xoe1) III. Show Description
Derived from C. briggsae strain AF16. Reference: Larson BJ, et al. Genetics. 2016 Jun 8. pii: genetics.116.191130.
|
|
JEL447 |
C. briggsae |
Cbr-met-2(xoe2) III. Show Description
Inappropriate targeting of H3K9me2 and H3K9me3. Derived from C. briggsae strain AF16. Reference: Larson BJ, et al. Genetics. 2016 Jun 8. pii: genetics.116.191130.
|
|
JH3477 |
C. elegans |
meg-3(ax3051[meg-3::OLLAS]) meg-4(ax3052) X. Show Description
P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
JH3553 |
C. elegans |
meg-3(ax4503[del(1-544)::OLLAS]) meg-4(ax4504) X. Show Description
Description: 20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (1-544); MEG-3 does not form a cytoplasmic gradient but does still form granules in early embryos and co-localizes with PGL-3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
JH3861 |
C. elegans |
meg-3(ax4502[meg-3(F705A,Y708A,Y713A, N725A)::OLLAS]) meg-4(ax3052) X. Show Description
20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
|
|
JU3143 |
Mesorhabditis okuensis |
Mesorhabditis okuensis wild isolate. Show Description
Mesorhabditis okuensis wild isolate. Male-female strain: maintain by crossing. Typically very few males on plates (only 10%); might be necessary to transfer large chunks to the new plates to ensure enough males are transferred. This species displays a striking reproductive system (described in Grosmaire & al. Science 2019. doi: 10.1126/science.aau0099).
|
|
LP847 |
C. elegans |
lea-1(cp423[myo-2p::GFP::myo-2 3UTR]) V. Show Description
Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP852 |
C. elegans |
daf-2(e1370) III; lea-1(cp423[myo-2p::GFP::myo-2 3UTR]) V. Show Description
Maintain at 15C. Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP858 |
C. elegans |
lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP859 |
C. elegans |
lea-1(cp430[lea-1::mYPet::3x FLAG]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mYPet. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP860 |
C. elegans |
daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP861 |
C. elegans |
daf-2(e1370) III; lea-1(cp430[lea-1::mYPET::3x FLAG]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mYPET. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
MBA227 |
C. elegans |
wIs51 V; icbSi2. Show Description
wIs51 [SCMp::GFP + unc-119(+)]. icbSi2 [dpy-7p::mCherry::H2B::unc-54 + Cbr-unc-119(+)]. Seam cell nuclei labelled with GFP. hyp7 nuclei labelled with mCherry. Reference: Hintze M, et al. Genetics. 2020 Apr;214(4):927-939. doi: 10.1534/genetics.119.302896. PMID: 31988193.
|
|
MG827 |
C. elegans |
unc-119(ed3) III; xsSi36 IV. Show Description
xsSi36 [myo-2p::GFP(Y66C)::let-858 3'UTR + Cbr-unc-119(+) IV:13,048,924]. This strain contains a non-fluorescent GFP that can be used to enrich for CRISPR mediated, oligodirected homologous recombination. [NOTE: previously published as mgSi36.] Reference: Zhang D & Glotzer M. 2014. Efficient site-specific editing of the C. elegans genome. doi: http://dx.doi.org/10.1101/007344.
|
|
MLC1777 |
C. elegans |
vha-1(luc132) III. Show Description
vha-1 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1778 |
C. elegans |
vha-13(luc133) V. Show Description
vha-13 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1779 |
C. elegans |
vha-14(luc134) III. Show Description
vha-14 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1801 |
C. elegans |
vha-8(luc135) IV. Show Description
vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1947 |
C. elegans |
dct-1(luc145) X. Show Description
dct-1 gain-of-function allele created by replacing two miR-1 binding sites (ACATTCCA) in the 3' UTR of the endogenous locus with NotI (GCGGCCGC) restriction sites. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|