fxSi3 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, I:2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. Five generations of lab adaptation following genome editing, all in the CB4856 background. Reference: Kasimatis, KR et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

LETHAL LATE LARVAL SEX-INFLUENCED Maintain by picking WT.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

he278 is a CRISPR-induced deletion of ebp-2. he279 is a deletion removing ebp-1, Y59A8B.25 & ebp-3. Low penetrance of pleiotropic phenotypes among adults, including low frequency of dumpy, sterile and/or uncoordinated animals and nonviable larvae that explode through the vulva. Some adults develop irregularities that seem to represent epidermal bulges. Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038

flvEx5 [rig-3p::wArchon1::GFP + elt-2p::nGFP]. Pick GFP+ to maintain. Expresses voltage sensor wArchon1 in AVA, tagged with GFP, as well as GFP in the gut from the co-injection marker.

mjEx331 [eft-3p::pash-1::GFP::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. Maintain at 25C. Array rescues pash-1 lethality and should be self-selecting at 25C. Pick mCherry(+) animals to confirm presence of array. SX1359 was derived from SX1137 pash-1(mj100). mj100 homozygotes can be re-isolated by raising SX1359 at permissive temperature (15C) and picking animals that have lost the array. Reference: Lehrbach NJ, et al. RNA. 2012 Dec;18(12):2220-35.

prp-8(az29) is a G654E missense mutation. az29 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). It changes cryptic splicing of e936 to allow for an increase in full-length unc-73 expression. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666.

snrp-27(az56) is a M141T missense allele with semi-dominant suppression of e936. No phenotype on its own. az56 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). This allele activates many dozens of alternative 5' splice sites in an RNA-seq experiment. snrp-27 is a component of the tri-snRNP and pre-B spliceosomal complexes. Reference: Zahler AM, et al. RNA. 2018 Oct;24(10):1314-1325. doi: 10.1261/rna.066878.118. PMID: 30006499.

prp-8(az119) is a D1549N missense allele. az119 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). az119 suppresses unc-73(e936) uncoordination through activation of cryptic splicing that promotes full length UNC-73 production. Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655.

az123 is an N18K missense allele altering 5' cryptic splicing usage. az123 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. dma-1(wy908) is a partial loss of function allele generated by CRISPR/Cas9-induced frame shift with multiple premature stop codons (n=6, 8 bp deletion). Fluorescent PVD- and FLP-specific morphology markers. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

csEx436 [lpr-3 (fosmid WRM619dE09) + myo-2p::mCherry]. Pick mCherry+ animals to maintain. cs231 is a Crispr/Cas9-induced null allele of lpr-3: a 13 nucleotide deletion in exon 1 results in frameshift. Homozygous mutants are embryonic lethal, but are rescued by csEx436 containing lpr-3(+) fosmid WRM619dE09. NOTE: lpr-3(cs231) should be considered the canonical allele as ok2351 also perturbs expression of adjacent gene lpr-6. Reference: Forman-Rubinsky R, Cohen JD and Sundaram MV. Genetics. 2017 Oct;207(2):625-642.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).

Superficially wild-type. Hypersensitive to selenium-induced motility impairment, but not lethality. Reference: Morgan KL, et al., Toxicol Sci. 2010 Dec;118(2):530-43.

wbmIs60 [pie-1p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs60 can be used to direct germline-specific gene expression from the pie-1 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs61 [myo-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs61 can be used to direct muscle-specific gene expression from the myo-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs63 [myo-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs61] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs63 exhibits muscle-specific wrmScarlet expression driven the myo-3 promoter. Derived from parental strain WBM1126 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome (wbmIs61). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs65 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs66 can be used to direct neuron-specific gene expression from the rab-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs67 [eft-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs65] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs67 exhibits soma-specific wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs68 exhibits neuron-specific wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1141 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome (wbmIs66). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs72 [pie-1p::3XFLAG::GFP::unc-54 3'UTR *wbmIs60] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs72 exhibits germline-specific GFP expression driven the pie-1 promoter. Derived from parental strain WBM1119 by CRISPR-mediated insertion of GFP downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome (wbmIs60). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs81 [eft-3p::3XFLAG::GFP::SKL::unc-54 3'UTR *wbmIs65] (V:8645000). Ubiquitous expression of peroxisome-targeted GFP. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. Derived from parental strain WBM1140 by CRISPR-mediated insertion of peroxisome-targeted GFP downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome (wbmIs65). Outcrossed six times to WBM lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.

wbmIs76 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs76 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs88 [eft-3p::3XFLAG::dpy-10::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs67]. (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the soma-specific eft-3 promoter. wbmIs88 exhibits soma-specific dpy-10 and wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1143 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs89 [rab-3p::3xFLAG::dpy-10::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs68] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the neuron-specific rab-3 promoter. wbmIs68 exhibits neuron-specific dpy-10 and wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1144 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs118 [myo-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs114] I. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in muscle. wrmScarlet expression in muscle. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs114. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

3xFlag tag inserted at N-temrinus of endogenous rpl-22 locus. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments.

wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433

Lacks L-isoaspartyl methyltransferase (E.C. 2.1.1.77) activity.

vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.

Probably null calreticulin. W28 amber. Slow growth (one day developmental delay). Nearly sterile if raised at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.

Probably null W231opa. Probably null calreticulin - slow growth (one day developmental delay). Nearly sterile if reared at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.

Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head.

Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head.

hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter. When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.

zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.