Search Strains

mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.

otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.

otSi4 [myo-2p::TIR1(F79G)::mRuby::unc-54 3'UTR *ieSi60] II. Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.

nsIs109 [F16F9.3p::DTA(G53E) + unc-122::GFP]. Genetic ablation of AMsh glia by expression of diphtheria toxin under AMsh-specific promoter. unc-122::GFP co-injection marker expressed in coelomocytes. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7

cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.

Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.

Endogenous locus tagged with mKate2 using CRISPR/Cas9. Enables visualisation of this secreted AMP in the cuticle upon genetic or physical cuticle damage. Reference: Pujol N & Bringmann H. 2025. microPublication Biology. A knock-in translational reporter for NLP-29 reveals AMP secretion to the apical extracellular matrices following epidermal damage in Caenorhabditis elegans. 10.17912/micropub.biology.001435.

Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo-2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.

3xHA tag inserted into the C-terminus of the endogenous F53B6.4 locus. Insert: TACCCATACGACGTCCCAGACTACGCCTACCCATATGATGTCCCGGATTACGCTTACCCATACGATGTTCCAGATTACGCT. Wild type sequence with 30bp flanks: GAGATGATGGTTGTCCCATTGGTGGCTGCC*TAAacaatcgattcgacatcaatcttgaag. Knock-in with 30 bp flanks: GAGATGATGGTTGTCCCACTTGTGGCTGCCTACCCATACGACGTCCCAGACTACGCCTACCCATATGATGTCCCGGATTACGCTTACCCATACGATGTTCCAGATTACGCTTAAacaatcgattcgacatcaatcttgaag

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F49B2.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagCGATCTGGACGCCCAGCAACCCCTACCGCCA. Right flanking sequence: CACCTCATCCCACCGTCGAACCCGTGTATGTGTCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGGTGGGATGAGGTGTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F31E8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTCTTCAGCTGGTGGAAAACTGGATCTCT. Right flanking sequence: GTCTGgtaagtctatatacttcggacacattcaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGAAAACTGGATCTCTGTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F54G2.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cctgccaaaccgatgttttattgcagAGTCCAAGC. Right flanking sequence: GTCAGATGGGAACTTTTTCGAAAAAGTAACTGCTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGTTCCCATCTGACGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53A10.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gatcATGTTCCACGTGTCAACAATGCTACCGTATAC. Right flanking sequence: TATTGGAGACGCCCAGCAGCTTCAAAGAAAACGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAATGCTACCGTATACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F36G3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGATTACGCACCCACACAGCCCGTGTACCATCC. Right flanking sequence: AAGCAGTCATGTAACAGCTCCACCGTACCATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGTTACATGACTGCTTGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53H1.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGCCGGATATTGAGCCATGGGACCGGTTTCGC. Right flanking sequence: GACTGGCTTCACTGCATTTGTGTGGTCACGTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATGGGACCGGTTTCGCGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F56F10.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cttttttgaattctagTCACCATTTGGACCGGTT. Right flanking sequence: AACAGCGTCTGATGGGGCAAGCATTCAAGAGACTTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCCCATCAGACGCTGTTAAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F58G6.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATAATTCAATGGATATGGACATGAATCAAGGACCTTTC. Right flanking sequence: ATGTGGATGTGGTTTCATACAAAACCACAAGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAACCACATCCACATGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of M03C11.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCTTCAGCATTTTTCAGTCATACGGAGCATT. Right flanking sequence: GGGCGGGGAGCTTTTGGAAAAgttagttggttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTCATACGGAGCATTGGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAGGAGAAGATCAAGGAAAAAAGCCGTAAGA. Right flanking sequence: GGAAGGCTCCAACTGCAGATGAAGCAATTGGAAATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAAAAAGCCGTAAGAGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F59C12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGCGACGAGTGCATGCAGTGCCACCGACACCCATGT. Right flanking sequence: ATCAGGGAGAGACGAACATTTTAGACTCACTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCACCGACACCCATGTATC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R08E3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTTTCATCAGAGACGCTTGCCGACATCTT. Right flanking sequence: GAGTGgtatgttttttgtctgaaatctaattttattc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCTTGCCGACATCTTGAG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTCAATAGTTGCTATTGTGGCAGTGATTATAA. Right flanking sequence: CAACGGCAATATGGCTCACGgttagtttaaatatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGGCAGTGATTATAACAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGATGCATTTCTTGCAAATTGCGACTGCCGTTA. Right flanking sequence: TGAGTCACGAAACACTGTGCTCTTAAAAGTAGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTGTTTCGTGACTCATAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATATTTTTAATATTTTTTATTTTTCGACTCCAGGC. Right flanking sequence: GCAAGgtaagtaagaattattgttttttatttatt. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCTTACTTACCTTGCGCC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E7.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAAAGAAGCAGAGATAATTAATGGTGAAACCAGAA. Right flanking sequence: TGGATGTGAACAGAACATCCGAACTCGAGgtttta. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTCTGTTCACATCCATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T08G3.13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctattttgattgaattATGTCTGTTATCGAGTTATGTGT. Right flanking sequence: CGGAGGACAGAAGTTCACAACGACGAAAACTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATCGAGTTATGTGTCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

T13C2.6. Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of gldi-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGATTTCAATGGCCACCATTTCGGTGGGCCTCCA. Right flanking sequence: ACCGATGGGAGCACCTACAAGAAgtatgttttc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAGGTGCTCCCATCGGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gst-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGACTTATCAAAATGACCCTTAAATTCTCCTACT. right flanking sequence: TTGGAACCCGCGGTATCGGTGAGCCGATTCGTATG. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATACCGCGGGTTCCAAAGT. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type but reduced brood size/early eggs laid/fewer viable eggs. CRISPR/Cas9 engineered STOP-IN null mutant of pam-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTTCAGAATGGCGGCCTGTGGAAACCCAAGCG. right flanking sequence: CGGCGGTCAAATTTGAGAGGCTTCCAACATTCGCC. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTGGAAACCCAAGCGCGG. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID*::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024].

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nas-22. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTTTATTCTTCTCTCAATTTTACAAGAGTGCTATG. right flanking sequence: GAAAGGATATTGTTGCAAGAATTGGTGGAAGAAATG. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTACAAGAGTGCTATGGAA. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.

syIs483 [unc-17p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + ceh-19p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] X. Split cGAL driver for MC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA; right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616