OH16290 |
C. elegans |
otIs670 V; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
OH16781 |
C. elegans |
otIs796 X. Show Description
otIs796 [flp-12(promDEL3)::GFP + unc-122p::RFP] X. SMB is marked only with GFP, not red. Can be used to isolate SMB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). This strain carries unc-122p::RFP as a co-injection marker labeling coelomocytes, which can bleed through the green channel; it is not known which red variant was used in the co-injection marker. Make sure the sorted green cells are also not red. Derived by integration of array originally generated in Kyuhyung Kim's lab.
|
|
OH17582 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID]) I; otSi2 II; daf-2(e1370) III. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
OH19124 |
C elegans |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
OH19206 |
C elegans |
golg-4(ot1510[mScarlet-I3::golg-4]) III. Show Description
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
OH19232 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
OS2248 |
C. elegans |
nsIs109. Show Description
nsIs109 [F16F9.3p::DTA(G53E) + unc-122::GFP]. Genetic ablation of AMsh glia by expression of diphtheria toxin under AMsh-specific promoter. unc-122::GFP co-injection marker expressed in coelomocytes. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7
|
|
PD2882 |
C. elegans |
unc-54(cc2882[unc-54[G387R]::gfp::TAA::NSUTR]) I. Show Description
cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.
|
|
PHX7377 |
C. elegans |
nlp-7b(syb7377[nlp-7b::SL2::GFP::H2B]) X. Show Description
Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
PHX945 |
C.elegans |
nish-1(syb767) IV; sybIs62. Show Description
sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo-2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.
|
|
PS10001 |
C. elegans |
F49B2.6(sy2028) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F49B2.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagCGATCTGGACGCCCAGCAACCCCTACCGCCA. Right flanking sequence: CACCTCATCCCACCGTCGAACCCGTGTATGTGTCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGGTGGGATGAGGTGTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10012 |
C. elegans |
F31E8.4(sy2030) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F31E8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTCTTCAGCTGGTGGAAAACTGGATCTCT. Right flanking sequence: GTCTGgtaagtctatatacttcggacacattcaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGAAAACTGGATCTCTGTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10014 |
C. elegans |
F54G2.1(sy2032) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F54G2.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cctgccaaaccgatgttttattgcagAGTCCAAGC. Right flanking sequence: GTCAGATGGGAACTTTTTCGAAAAAGTAACTGCTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGTTCCCATCTGACGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10016 |
C. elegans |
F53A10.2(sy2034) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53A10.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gatcATGTTCCACGTGTCAACAATGCTACCGTATAC. Right flanking sequence: TATTGGAGACGCCCAGCAGCTTCAAAGAAAACGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAATGCTACCGTATACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10018 |
C. elegans |
F36G3.3(sy2036) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F36G3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGATTACGCACCCACACAGCCCGTGTACCATCC. Right flanking sequence: AAGCAGTCATGTAACAGCTCCACCGTACCATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGTTACATGACTGCTTGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10020 |
C. elegans |
F53H1.3(sy2038) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53H1.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGCCGGATATTGAGCCATGGGACCGGTTTCGC. Right flanking sequence: GACTGGCTTCACTGCATTTGTGTGGTCACGTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATGGGACCGGTTTCGCGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10022 |
C. elegans |
F56F10.1(sy2040) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F56F10.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cttttttgaattctagTCACCATTTGGACCGGTT. Right flanking sequence: AACAGCGTCTGATGGGGCAAGCATTCAAGAGACTTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCCCATCAGACGCTGTTAAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10060 |
C. elegans |
F58G6.3(sy2042) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F58G6.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATAATTCAATGGATATGGACATGAATCAAGGACCTTTC. Right flanking sequence: ATGTGGATGTGGTTTCATACAAAACCACAAGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAACCACATCCACATGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10062 |
C. elegans |
M03C11.1(sy2044) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of M03C11.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCTTCAGCATTTTTCAGTCATACGGAGCATT. Right flanking sequence: GGGCGGGGAGCTTTTGGAAAAgttagttggttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTCATACGGAGCATTGGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10064 |
C. elegans |
R12C12.5(sy2046) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAGGAGAAGATCAAGGAAAAAAGCCGTAAGA. Right flanking sequence: GGAAGGCTCCAACTGCAGATGAAGCAATTGGAAATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAAAAAGCCGTAAGAGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10066 |
C. elegans |
F59C12.3(sy2048) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F59C12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGCGACGAGTGCATGCAGTGCCACCGACACCCATGT. Right flanking sequence: ATCAGGGAGAGACGAACATTTTAGACTCACTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCACCGACACCCATGTATC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10068 |
C. elegans |
R08E3.3(sy2050) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R08E3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTTTCATCAGAGACGCTTGCCGACATCTT. Right flanking sequence: GAGTGgtatgttttttgtctgaaatctaattttattc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCTTGCCGACATCTTGAG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10155 |
C. elegans |
T05C3.6(sy2066) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTCAATAGTTGCTATTGTGGCAGTGATTATAA. Right flanking sequence: CAACGGCAATATGGCTCACGgttagtttaaatatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGGCAGTGATTATAACAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10157 |
C. elegans |
R12C12.6(sy2068) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGATGCATTTCTTGCAAATTGCGACTGCCGTTA. Right flanking sequence: TGAGTCACGAAACACTGTGCTCTTAAAAGTAGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTGTTTCGTGACTCATAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10158 |
C. elegans |
T05E12.3(sy2069) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATATTTTTAATATTTTTTATTTTTCGACTCCAGGC. Right flanking sequence: GCAAGgtaagtaagaattattgttttttatttatt. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCTTACTTACCTTGCGCC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10160 |
C. elegans |
T05E7.3(sy2072) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E7.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAAAGAAGCAGAGATAATTAATGGTGAAACCAGAA. Right flanking sequence: TGGATGTGAACAGAACATCCGAACTCGAGgtttta. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTCTGTTCACATCCATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10162 |
C. elegans |
nlp-50(sy2074) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10163 |
C. elegans |
T08G3.13(sy2075) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T08G3.13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctattttgattgaattATGTCTGTTATCGAGTTATGTGT. Right flanking sequence: CGGAGGACAGAAGTTCACAACGACGAAAACTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATCGAGTTATGTGTCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10165 |
C. elegans |
nlp-51(sy2053) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10170 |
C. elegans |
gldi-2(sy2058) II. Show Description
T13C2.6. Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of gldi-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGATTTCAATGGCCACCATTTCGGTGGGCCTCCA. Right flanking sequence: ACCGATGGGAGCACCTACAAGAAgtatgttttc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAGGTGCTCCCATCGGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS10640 |
C. elegans |
cmk-1(sy2277[cmk-1::mKate2::AID*::3xFLAG) IV; syIs875. Show Description
syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024].
|
|
PS5970 |
C. elegans |
him-5(e1490) syIs197 V. Show Description
syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.
|
|
PS7521 |
C. elegans |
syIs483 X; syIs300. Show Description
syIs483 [unc-17p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + ceh-19p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] X. Split cGAL driver for MC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFPÂ marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
PS7731 |
C. elegans |
K03E5.2(sy1082) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT;
right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG
Reference: Wang H, et al. G3 (Bethesda).
|
|
PS7734 |
C. elegans |
T05C3.2(sy1080) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA
Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC
inserted sequence between the two flanking sequence (STOP-In casette):
GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7778 |
C. elegans |
clik-1(sy1084) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6)
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG;
right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
PS7783 |
C. elegans |
K03E5.2(sy1086) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG
Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7833 |
C. elegans |
Y106G6H.8(sy1076) I. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT;
right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
PS7837 |
C. elegans |
aex-2(sy1078) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG
Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7858 |
C. elegans |
C01B10.10(sy1114) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT
Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7909 |
C. elegans |
C56G2.15(sy1120) III. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA;
right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
PS7911 |
C. elegans |
C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2.
lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG;
right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
PS7922 |
C. elegans |
C01B10.4(sy1131) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7951 |
C. elegans |
adm-4(sy1161) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7953 |
C. elegans |
C23H4.2(sy1163) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7960 |
C. elegans |
C04G6.4(sy1165) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS7962 |
C. elegans |
ttc-36(sy1167) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS8008 |
C. elegans |
ZC376.2(sy1170) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS8010 |
C. elegans |
cpn-4(sy1172) I. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of cpn-4 (F49D11.8).
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGCAAGCAAGTTCAATGATGTTGAAGCTGGATACT;
right flanking sequence: TGTTGGAATGGATTCGGgtaagatttgggtagatt;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|