Reduced fertility. Reduced long-term survival. Mutator phenotype. DNA damage-induced apoptosis in the germ line. No effect on lifespan or meiotic chromosome disjunction observed.

Loopy, uncoordinated movement. Hyperactive. Nose touch-insensitive. Osm.

Loopy, uncoordinated movement. Hyperactive. Nose touch-insensitive. Osm.

otEx5141 [hsp::tbx-37 + hsp::tbx-38 + elt-2p::DsRed]. Maintain by picking animals with dsRed in intestinal nuclei. Transcription factors TBX-37 and TBX-38 are ectopically expressed under control of a heat shock-inducible promoter. otIs235 [che-1p::mCherry + rol-6(su1006)]. otIs252 [lsy-6(+)(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.

bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID). Reference: Kerk SY, et al. Neuron 2017 (in press).

mab-9(ot863[mab-9::TagRFP::AID]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron 2017 (in press).

otIs657 [klp-6p::mCherry + flp-3p::mCherry + klp-6p::NLG1::GFP1-10 + flp-3p::NLG1::GFP11]. IL2-IL1 GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain.

wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. See description of strain OH15263 for full description of otIs670 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

otIs796 [flp-12(promDEL3)::GFP + unc-122p::RFP] X. SMB is marked only with GFP, not red. Can be used to isolate SMB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). This strain carries unc-122p::RFP as a co-injection marker labeling coelomocytes, which can bleed through the green channel; it is not known which red variant was used in the co-injection marker. Make sure the sorted green cells are also not red. Derived by integration of array originally generated in Kyuhyung Kim's lab.

nsIs109 [F16F9.3p::DTA(G53E) + unc-122::GFP]. Genetic ablation of AMsh glia by expression of diphtheria toxin under AMsh-specific promoter. unc-122::GFP co-injection marker expressed in coelomocytes. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7

cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.

Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo- 2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F49B2.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagCGATCTGGACGCCCAGCAACCCCTACCGCCA. Right flanking sequence: CACCTCATCCCACCGTCGAACCCGTGTATGTGTCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGGTGGGATGAGGTGTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F31E8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTCTTCAGCTGGTGGAAAACTGGATCTCT. Right flanking sequence: GTCTGgtaagtctatatacttcggacacattcaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGAAAACTGGATCTCTGTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F54G2.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cctgccaaaccgatgttttattgcagAGTCCAAGC. Right flanking sequence: GTCAGATGGGAACTTTTTCGAAAAAGTAACTGCTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGTTCCCATCTGACGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53A10.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gatcATGTTCCACGTGTCAACAATGCTACCGTATAC. Right flanking sequence: TATTGGAGACGCCCAGCAGCTTCAAAGAAAACGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAATGCTACCGTATACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F36G3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGATTACGCACCCACACAGCCCGTGTACCATCC. Right flanking sequence: AAGCAGTCATGTAACAGCTCCACCGTACCATTACC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGTTACATGACTGCTTGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F53H1.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGCCGGATATTGAGCCATGGGACCGGTTTCGC. Right flanking sequence: GACTGGCTTCACTGCATTTGTGTGGTCACGTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATGGGACCGGTTTCGCGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F56F10.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cttttttgaattctagTCACCATTTGGACCGGTT. Right flanking sequence: AACAGCGTCTGATGGGGCAAGCATTCAAGAGACTTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCCCATCAGACGCTGTTAAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F58G6.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATAATTCAATGGATATGGACATGAATCAAGGACCTTTC. Right flanking sequence: ATGTGGATGTGGTTTCATACAAAACCACAAGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAACCACATCCACATGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of M03C11.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCTTCAGCATTTTTCAGTCATACGGAGCATT. Right flanking sequence: GGGCGGGGAGCTTTTGGAAAAgttagttggttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTCATACGGAGCATTGGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAGGAGAAGATCAAGGAAAAAAGCCGTAAGA. Right flanking sequence: GGAAGGCTCCAACTGCAGATGAAGCAATTGGAAATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAAAAAAGCCGTAAGAGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F59C12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGCGACGAGTGCATGCAGTGCCACCGACACCCATGT. Right flanking sequence: ATCAGGGAGAGACGAACATTTTAGACTCACTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCACCGACACCCATGTATC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R08E3.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTTTCATCAGAGACGCTTGCCGACATCTT. Right flanking sequence: GAGTGgtatgttttttgtctgaaatctaattttattc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGCTTGCCGACATCTTGAG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCATTCAATAGTTGCTATTGTGGCAGTGATTATAA. Right flanking sequence: CAACGGCAATATGGCTCACGgttagtttaaatatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGGCAGTGATTATAACAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of R12C12.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGATGCATTTCTTGCAAATTGCGACTGCCGTTA. Right flanking sequence: TGAGTCACGAAACACTGTGCTCTTAAAAGTAGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGTGTTTCGTGACTCATAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATATTTTTAATATTTTTTATTTTTCGACTCCAGGC. Right flanking sequence: GCAAGgtaagtaagaattattgttttttatttatt. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCTTACTTACCTTGCGCC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E7.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAAAGAAGCAGAGATAATTAATGGTGAAACCAGAA. Right flanking sequence: TGGATGTGAACAGAACATCCGAACTCGAGgtttta. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTTCTGTTCACATCCATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-50. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gcagtttcacacaaaccATGCGCTTCTCCGTCT. Right flanking sequence: TTGTTGCTCTATTTGCTCTTCTTGCTGTCTCTTATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCAAATAGAGCAACAAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T08G3.13. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctattttgattgaattATGTCTGTTATCGAGTTATGTGT. Right flanking sequence: CGGAGGACAGAAGTTCACAACGACGAAAACTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATCGAGTTATGTGTCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtttttcttcagtttcaaatcaaaATGCGATTCCTCA. Right flanking sequence: TCTTGGCTCTCCTCGTGCTCTTCGCCATCACCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAAAATGCGATTCCTCATCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T13C2.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGATTTCAATGGCCACCATTTCGGTGGGCCTCCA. Right flanking sequence: ACCGATGGGAGCACCTACAAGAAgtatgttttc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAGGTGCTCCCATCGGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.

syIs483 [unc-17p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + ceh-19p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] X. Split cGAL driver for MC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGG Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAA Right flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaattttcagAAGCTGGCCTCAAAATTGCCGCCG Right flanking sequence: TCTCGAGGTGCCAAGCAATGAACAATTGGAGAGGAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTGCTTGGCACCTCGACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATT Right flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C56G2.15. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGTGAGCATTCACAGAAAAAATCATGCCGTCA; right flanking sequence: GTCCCCTCCAATGTCGTTTTTGTTGCTCAATAAGG; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATACACACTTCATTTGGTCATTTGGAAGGTGCAGA Right flanking sequence: GATAGGAGATTATCATTTGTTCAAAAAAATTCCATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATTTGGAAGGTGCAGAGAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of adm-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTGTTGATGACACGTTACATCTAGAGCCATCT Right flanking sequence: TACCCGCATCAACTTTCTGATGATCTTGGGCCTGTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GAAAGTTGATGCGGGTAAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C23H4.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattgaaacgaagaccatgccatgcagttccagAG Right flanking sequence: TGTTCCGTTTGCAAAGCCACCAATTGGAAATTTGC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTTTGCAAACGGAACACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ttc-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGCTCAGTTTGCAGCTCGAGAGAGAAGGTGTCG Right flanking sequence: cCGTTGGCAGAAGGTGTACGGTTGGATGAAGCTATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAGAGAGAAGGTGTCGCGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616