Search Strains

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx345 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx345 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx345 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx328 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx328 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx328 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx339 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx339 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx339 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx326 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx326 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx326 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

Ndg: nordihydroguairetic acid resistant. Nrf: nose resistant to fluoxetine-induced hypercontraction. Pale eggs. Accumulates yolk. Some embryonic lethality. Nonsense mutation W404stop(UGA).

Hid. Insensitive to dauer-inducing pheromone.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Endogenous hsf-1 tagged with the auxin-inducible-degron (AID*) and GFP allows depletion of endogenous HSF-1 in the somatic tissues upon auxin treatment. Animals treated with 1mM of auxin when eggs are laid will arrest in L1 or L2 stage. Reference: Edwards SL, et al. Cell Rep. 2021 Aug 31;36(9):109623. PMID2021 Aug 31;36(9):109623. PMID: 34469721

CRISPR-engineered KO strain of haps-1 made by knock-in of tandem stop codons to the first exon of endogenous haps-1 locus. haps-1(C48B6.3) is the C. elegans ortholog of human HAPSTR1. haps-1(ljt1) is superficially wild-type when cultured at 20C, but is hypersensitive to paraquat (redox stress), MLN4924 (neddylation inhibition), and camptothecin (genotoxic stress). Reference: Amici DR, et al. Proc Natl Acad Sci U S A. 2022 Jul 5;119(27):e2111262119. doi: 10.1073/pnas.2111262119. PMID: 35776542.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.

DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

FP knock-in. mNG-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.

Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

kuIs36 [egl-26::GFP + unc-119(+)] II. Transcriptional fusion of GFP to egl-26 gene. Nuclear localized. Embryonic expression. Expressed in somatic gonad (uterus and spermatheca) and vulva in vulE and vulB in L4. Spermatheca expression persists into adulthood. Expressed in pharyngeal-intestinal junction cells and in tail.

Segregates WT, males, Dpy, Rol, DpyRol, dead eggs (mcDf2). Use XX tra-2 males to move mcDf2 around. mcDf2 is an approx. 500 kb deficiency removing a large chunk between mec-2 and sup-7 (non-inclusive).

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID*) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.

lbEx9 [R31A1(cosmid) + rol-6(su1006)]. Pick non-Unc Rol to maintain. This strain was obtained by co-injection of plasmid pRF4 and cosmid R13A1 into gonads of unc-8(e15) animals. Reference: Shreffler W, Wolinsky E. Behav Genet. 1997 May;27(3):211-21.

hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3'UTR+Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.

hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.