| GLW95 |
C. elegans |
F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. Show Description
C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.
|
|
| GOU1861 |
C. elegans |
wsp-1a(cas723[gfp::wsp-1a] IV; arx-2(cas725[arx-2::TagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. TagRFP inserted into the endogenous arx-2 gene at its C-terminus and GFP inserted into the endogenous wsp-1a gene at its N-terminus by Cas9-triggered homologous recombination.
|
|
| GOU2162 |
C. elegans |
che-3(cas443[gfp::che-3]) I; xbx-1(cas502[xbx-1::tagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
|
|
| GOU2187 |
C. elegans |
klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
|
|
| GS10037 |
C. elegans |
arSi159 [rps-27p::GFP(flexon)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II; unc-119(ed3) III. Show Description
arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
| GS9402 |
C. elegans |
arTi362 Show Description
arTi362 [rps-27p::TIR1(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (-19.98). The first intron of TIR1 was replaced with a Flexon containing two lox2272 sites. TIR1 is expressed at a high level in lineages where Cre is expressed. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
| GS9407 |
C. elegans |
arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.
|
|
| GS9820 |
C. elegans |
arTi443 Show Description
arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
| GS9847 |
C. elegans |
arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I (-4.81). First intron of GFP is replaced with a Flexon containing two loxP sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
| GS9922 |
C. elegans |
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
| GW1262 |
C. elegans |
xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
|
|
| GW304 |
C. elegans |
unc-119(ed3) III; gwIs28. Show Description
gwIs28 [myo-3::mCherry + 256xlacO + unc-119(+)]. Superficially wild-type. Contains a small lacO array co-integrated with a muscle specific mCherry reporter (~10x smaller than the gwIs4 array). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
|
|
| HAL240 |
C. elegans |
gtf-2H5(emcSi73[gtf-2H5-1::AID*::GFP]) III. Show Description
CRISPR/Cas9-engineered insertion of AID*::GFP tags into C-terminus of endogenous gtf-2H5 locus allowing auxin-induced degradation.
|
|
| HAL504 |
C. elegans |
gtf-2H1(emcSi202[AID*::GFP::gtf-2H1]) IV. Show Description
CRISPR/Cas9-engineered insertion of AID*::GFP tags into N-terminus of endogenous gtf-2H1 locus allowing auxin-induced degradation.
|
|
| HBR1021 |
C. elegans |
goeIs240. Show Description
goeIs240 [hsp-16.2p::flp-11::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Likely intergrated into LG I or LG III. Heat shock-induced over-expression of FLP-11 neuropeptide causes behavioral quiescence. Reference: Turek et al. eLife 2016;5:e12499.
|
|
| HML1012 |
C. elegans |
cshIs140 II; ieSi58 IV. Show Description
cshIs140 [rps-28p::TIR1(F79G)::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Ubiquitously expressed single copy, modified TIR1 allele, TIR1(F79G) that is compatible with 5-PH-IAA and can be used to deplete auxin-induced degradation-tagged (AID-tagged) proteins. Efficiently depletes target proteins at 1 µM 5-Ph-IAA. Nuclear localized mCherry co-expression marker. Reference: Hills-Muckey et al. Genetics. 2022 Feb 4;220(2):iyab174. doi: 10.1093/genetics/iyab174. PMID: 34739048.
|
|
| HS3528 |
C. elegans |
osIs158 II. Show Description
osIs158 [eft-3p::TIR1(F79G)::mRuby] II. Single copy insertion into ttTi5605 on LG II. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
|
|
| HS3545 |
C. elegans |
osIs158 II; ieSi58 IV. Show Description
osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
|
|
| HS3750 |
C. elegans |
ieSi58 IV; osIs182 V. Show Description
ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::TIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
|
|
| HT115(DE3) |
Escherichia coli |
E. coli [F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase]. Show Description
Bacteria. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase) (IPTG-inducible T7 polymerase) (RNAse III minus). This strain grows on LB or 2XYT plates. This strain is tetracycline resistant. Researchers using this strain should test for expression by transforming in one of the plasmids from the Fire Vector Kit (1999) (pLT76, e.g.) using standard CaCl2 transformation techniques. Biosafety Level: BSL-1.
|
|
| IC765 |
C. elegans |
npr-9(tm1652) X; quEx182. Show Description
quEx182 [npr-9(+) + sur-5::GFP + odr-1::RFP]. Maintain by picking GFP+. Rescuing npr genomic fragment co-injected with sur-5::GFP and odr-1::RFP]. transgenic (GFP+) animals tend to wander off the food.
|
|
| IJ1651 |
C. elegans |
mdt-15(yh44[mdt-15::AID*::EmGFP]) III. Show Description
AID* and EmGFP tag inserted at the 3' end of the endogenous mdt-15 gene locus by CRISPR/Cas9 engineering. This strain can be used for auxin-inducible degradation (AID) of MDT-15 protein. Reference: Lee D, et al. PLoS Biol. 2019 Aug 13;17(8):e3000415. doi: 10.1371/journal.pbio.3000415. PMID: 31408455.
|
|
| iOP50 |
E. coli |
OP50 E. coli, rnc14::(delta)Tn10, lacz(gamma)A::T7pol camFRT Show Description
RNAi-capable OP50 strain. Tetracycline & Chloramphenicol resistant. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. Standard OP50 (CGC) was rendered RNAi competent through two modifications by phage transduction. The OP50 RNase III (rnc) allele was replaced with the deletion allele (rnc14::ΔTn10) found in HT115(DE3), and a genomically encoded IPTG-inducible T7 RNA polymerase (laczγA::T7pol camFRT) was introduced. Reference: Neve IAA, et al. G3 (Bethesda). 2019 Nov 11. pii: g3.400741.2019.
|
|
| IX4506 |
C elegans |
mls-2(vy248[mNG::mls-2]) X. Show Description
mNG tag inserted into endogenous mls-2 locus after the start codon using CRISPR/Cas9 engineering, producing a translational mNG::MLS-2 reporter protein. Derived by SEC excision of mls-2(vy247[mNG::SEC::mls-2 knock-in]) in parental strain. mNG::MLS-2 is detected in the nucleus of a few cells in embryos, and localizes to the nucleus of a subset of head cells and the M mesoblast in larvae and adults. Reference: Xiong R., et al. (2022). mNG-tagged mls-2 knock-in alleles in C. elegans. microPublication Biology. 10.17912/micropub.biology.000529.
|
|
| JAZ454 |
C. elegans |
jlgEx220. Show Description
jlgEx220 [nep-2p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in nep-2 expressing cells, co-injected with a nuclear GFP intestinal marker. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
|
|
| JAZ515 |
C. elegans |
nep-2(ok2846) II; jlgEx251. Show Description
jlgEx251 [myo-3p::nep-2(cDNA)::wrmScarlet + elt-2p::GFP::NLS]. Maintain by picking GFP+ (intestinal nuclear). Extrachromosomal array with a red translational reporter for NEP-2 in myo-3 expressing muscle cells, co-injected with a nuclear GFP intestinal marker, in nep-2(ok2846) mutant background. Reference: Lo J, et al. Curr Biol. 2024 Oct 21;34(20):4715-4728.e4. doi: 10.1016/j.cub.2024.09.059. PMID: 39395417.
|
|
| JDW834 |
C. elegans |
unc-119(kst33) col-97(wrd346[col-97::internal mNG::3xFLAG + unc-119(+)]) III. Show Description
Superficially wild type. Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the endogenous col-97 locus by CRISPR to produce a translational fusion inserted internally near the C-terminus (after amino acid 288). Allele obtained using plasmid-based unc-119 selection. Injection of a Cre recombinase plasmid failed to excise the loxP-flanked unc-119(+) cassette for unknown reasons. The insert was verified to be correct through Sanger sequencing. Knock-in is linked to the temperature-sensitive unc-119(kst33) allele. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| JDW92 |
C. elegans |
wrdSi19 nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; him-5(e1490) V. Show Description
wrdSi19 [mex-5p::TIR1:F2A:mTagBFP2:AID*::NLS::tbb-2 3'UTR] (I:-5.32). Strain allows germline-specific depletion of NHR-23::AID*LLTEV::3xFLAG using the auxin-inducible degron system. wrdSi19 was made by crossing parental strain KRY87 to JDW83 [wrdSi10 (mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3′UTR+SEC, I:-5.32); him5(e1490) V] and using heatshock to remove the SEC. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
|
|
| JEL1000 |
C. elegans |
hsr-9(xoe17) I. Show Description
Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1134 |
C. elegans |
polq-1(xoe51) III. Show Description
Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1197 |
C. elegans |
wrdSi3 II; dpy-27(xoe41[dpy-27::AID::myc]) III; him-8(me4) IV. Show Description
wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID* element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.
|
|
| JK6154 |
C. elegans |
lst-1(q1086 [*q1004]) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif B disrupted (PIM B mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
|
|
| JK6203 |
C. elegans |
lst-1(q1125[*q1086]) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motifs A&B disrupted (PIM AB mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
|
|
| JK6381 |
C. elegans |
lst-1(q1124[*q1004]). Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif A disrupted (PIM A mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
|
|
| JK6721 |
C. elegans |
lst-1(q1086) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. PUF-interacting motif B (PIM B) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1086 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
|
|
| JK6722 |
C. elegans |
lst-1(q1124) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. PUF-interacting motif A (PIM A) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1124 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
|
|
| JMC151 |
C. elegans |
csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
|
|
| JMC201 |
C. elegans |
alg-1(tor137[GFP::3xFLAG::alg-1b]) X. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-1 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
| JMC203 |
C. elegans |
alg-2(tor139[GFP::3xFLAG::alg-2b]) II. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-2 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
| JMC211 |
C. elegans |
ergo-1(tor147[GFP::3xFLAG::ergo-1a]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous ergo-1 locus; specifically tags a-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
| JMC225 |
C. elegans |
ppw-1(tor119[GFP::3xFLAG::ppw-1c]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous ppw-1; specifically tags c-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
| JMC227 |
C. elegans |
sago-2(tor121[GFP::3xFLAG::sago-2c]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous sago-2; specifically tags c-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
| JN147 |
C. elegans |
gap-2(tm748) X. Show Description
No apparent phenotype. tm748 is a UV/TMP-induced gap-2 deletion allele generated by National Bioresource Project (see http://shigen.lab.nig.ac.jp/c.elegans/index.jsp?lang=englis h for info).
|
|
| JN213 |
C. elegans |
iff-1(tm483)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate sterile iff-1 homozygotes and Dumpy sterile qC1 homozygotes. Maintain by picking non-Dpy fertile heterozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani.
|
|
| JN215 |
C. elegans |
iff-1(tm483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| JN2722 |
C. elegans |
daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
|
|
| JPS325 |
C. elegans |
slo-1(js379)V; vxEx325. Show Description
vxEx325 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx325 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx325 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
|
|
| JPS327 |
C. elegans |
slo-1(js379)V; vxEx327. Show Description
vxEx327 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx327 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx327 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
|
|
| JPS338 |
C. elegans |
slo-1(js379)V; vxEx338. Show Description
vxEx338 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx338 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx338 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
|
|
| JPS344 |
C. elegans |
slo-1(js379)V; vxEx344. Show Description
vxEx344 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx344 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx344 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
|
|