More Fields
Strain Species Genotype
JT529 C. elegans ndg-4(sa529) III. Show Description
Ndg: nordihydroguairetic acid resistant. Nrf: nose resistant to fluoxetine-induced hypercontraction. Pale eggs. Accumulates yolk. Some embryonic lethality. Nonsense mutation W404stop(UGA).
JT646 C. elegans hid-3(sa646) I. Show Description
Hid. Insensitive to dauer-inducing pheromone.
JTL611 C. elegans hsf-1(ljt3[hsf-1::degron::gfp]) I; ieSi57 II; unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Endogenous hsf-1 tagged with the auxin-inducible-degron and GFP allows depletion of endogenous HSF-1 in the somatic tissues upon auxin treatment. Animals treated with 1mM of auxin when eggs are laid will arrest in L1 or L2 stage. Reference: Edwards SL, et al. Cell Rep. 2021 Aug 31;36(9):109623. PMID2021 Aug 31;36(9):109623. PMID: 34469721
KRY85 C. elegans ieSi57 II; nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
KRY88 C. elegans nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
KWN190 C. elegans pha-1(e2123) III; him-5(e1490) V; rnyEx109. Show Description
rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.
LBV5 C. elegans str-217(ejd1) V. Show Description
DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA
LP184 C. elegans mom-5(cp31[mom-5::YPET + LoxP]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP228 C. elegans dsh-2(cp51[mNeonGreen::dsh-2]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP435 C elegans apr-1(cp166[mNG-C1^3xFlag::apr-1]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP439 C elegans nud-2(cp170[nud-2::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP443 C elegans klp-17(cp174[klp-17::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP447 C elegans klp-7(cp178[klp-7::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP451 C elegans bicd-1(cp180[mNG-C1^3xFlag::bicd-1]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP521 C elegans klp-12(cp234[klp-12::mNG-C1^3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP527 C elegans mes-1(cp240[mes-1::mNG-C1^3xFlag] X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP530 C elegans cam-1(cp243[cam-1::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP538 C. elegans gsk-3(cp251[gsk-3::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP560 C elegans dhc-1(cp268[dhc::mNG-C1::3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP563 C elegans dnc-1(cp271[dnc::mNG-C1::3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP585 C elegans lin-5(cp288[lin-5::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP591 C elegans lis-1(cp294[lis-1::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP598 C elegans dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP600 C elegans klp-4(cp303[klp-4::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP604 C elegans klp-8(cp307[klp-8::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP608 C elegans klp-20(cp311[klp-20::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP697 C. elegans mom-5(cp367[mom-5::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP705 C elegans dsh-1(cp375[dsh-1DIX::mNG-C1^3xFlag::PDZ,DEP]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP713 C elegans pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP728 C elegans mig-5(cp385[mNG-GLO::AID::mig-5]) II. Show Description
FP knock-in. mNG-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.
LP858 C. elegans lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP860 C. elegans daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
MH1564 C. elegans kuIs36 II. Show Description
kuIs36 [egl-26::GFP + unc-119(+)] II. Transcriptional fusion of GFP to egl-26 gene. Nuclear localized. Embryonic expression. Expressed in somatic gonad (uterus and spermatheca) and vulva in vulE and vulB in L4. Spermatheca expression persists into adulthood. Expressed in pharyngeal-intestinal junction cells and in tail.
ML503 C. elegans tra-2(q276)/rol-6(e187) II; mcDf2/dpy-8(e130) X. Show Description
Segregates WT, males, Dpy, Rol, DpyRol, dead eggs (mcDf2). Use XX tra-2 males to move mcDf2 around. mcDf2 is an approx. 500 kb deficiency removing a large chunk between mec-2 and sup-7 (non-inclusive).
MLC1065 C. elegans pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1245 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1726 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1729 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MP150 C. elegans unc-8(e15) IV; lbEx9. Show Description
lbEx9 [R31A1(cosmid) + rol-6(su1006)]. Pick non-Unc Rol to maintain. This strain was obtained by co-injection of plasmid pRF4 and cosmid R13A1 into gonads of unc-8(e15) animals. Reference: Shreffler W, Wolinsky E. Behav Genet. 1997 May;27(3):211-21.
MQD2356 C. elegans hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3’UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2374 C. elegans ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2375 C. elegans daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.
MQD2378 C. elegans hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2379 C. elegans hqSi10 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2383 C. elegans hqSi11 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2402 C. elegans daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; hqSi12 IV. Show Description
hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2428 C. elegans daf-2(hq363[daf-2::degron::mNeonGreen]) III. Show Description
Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. The double tag of a degron sequence and a fluorescent protein sequence enables facile detection of the expression of the fusion protein and auxin-induced DAF-2 protein degradation. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2433 C. elegans daf-16(hq389[daf-16::gfp::degron]) I. Show Description
GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.The double tag of a degron sequence and a fluorescent protein sequence enables facile detection of the expression of the fusion protein and auxin-induced DAF-16 protein degradation. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2453 C. elegans ieSi57 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2491 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.