muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped.

muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muIs126 [myo-3p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Gamma irradiation-induced integration of muEx215. Rescues daf-16a1/c in muscles (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muEx353 [kri-1(cDNA, a-isoform)::GFP + odr-1p::RFP]. Pick RFP+ to maintain. Temperature sensitive. Sterile at 25C; maintain at 15-20C. Reference: Berman JR and Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.

muIs142 [ges-1p::GFP::daf-16(cDNA) + odr-1p::RFP]. Maintain at 15-20C. Gamma irradiation-induced integration of muEx268. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muIs42[mig-13::GFP + dpy-20(+)]. non-Dpy strain. GFP+ in ventral cord cells, pharyngeal-intestinal valve cells.

Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)

rgEx161[lev-11p::UNC-43g + gtl-1p::CFP]. rgEx161 rescues unc-43(sy574)-induced spicule protraction.

rgEx173 [unc-103ep::egl-2(cDNA) + gtl-1p::CFP]. Pick animals with cyan fluorescence in their intestines. rgEx173 rescues food deprivation's ability to suppress unc-103(n1213)-induced male sex muscle seizures.

rgEx178 [lev-11p::daf-2(+) + lev-11p::GFP]. rgEx178 rescues food deprivation suppression of unc-103(n1213)-induced spicule protraction.

rgEx180 [aex-3p::daf-2(+) + tnt-4p::GFP]. rgEx180 reduces unc-103(n1213)-induced spicule protraction, and rescues constitutive dauer formation.

rgEx247 [hsp-16p::daf-2(+) + lev-11p::GFP]. rgEx247 restores food-deprivation suppression of unc-103(n1213)-induced spicule protraction.

umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.

dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.

dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.

twnEx185 [mec-7p::MTS::roGFP + mec-7p::TOMM20::mCherry + ttx-3p::GFP]. Pick animals with GFP expression in head neurons (AIY) to maintain. roGFP can be used to monitor redox status of the mitochondrial matrix in the six touch receptor neurons: the oxidation-reduction status of mitochondrial matrix can be monitored with roGFP, a GFP variant that increases brightness in a more oxidized environment. The mitochondrial outer membrane in these neurons are marked by mCherry. Reference: Jiang HC, et al. Proc Natl Acad Sci USA. 2015 Jul 14;112(28):8768-73. doi: 10.1073/pnas.1501831112. PMID: 26124107. [NOTE: twnEx185 is incorrectly described as carrying myo-2p::GFP in the reference publication. The correct co-injection marker is ttx-3::GFP.]

kyEx728 [sra-6p::G-CaMP]. No co-injection marker -- pick GFP+ animals to maintain.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

bmdSi284 [loxN::rpl-28p::TIR1(F79G)::T2A::DHB::2xmKate2] I. bmdSi284 is a single copy CRISPR/Cas9 insertion that ubiquitously co-expresses the mutant version of TIR1 for improved auxin-inducible degradation via 5-Ph-IAA and a CDK activity sensor consisting of a fragment of human DNA helicase B (DHB) fused to two copies of mKate2. Reference: Martinez MAQ, et al. Biology Open. 2022 Dec 15;11(12):bio059668. doi: 10.1242/bio.059668.

bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.

bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi208 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi207 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.

oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in hypodermis. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in muscles. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.