| RB1238 |
C. elegans |
hmg-11(ok1303) II. Show Description
T05A7.4 Homozygous. Outer Left Sequence: ctcgtggaagccctagacag. Outer Right Sequence: catcgggaaagtacggaaga. Inner Left Sequence: tcagatggtatgatcgccaa. Inner Right Sequence: tcagactgtcacatcgctcc. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| BC11307 |
C. elegans |
dpy-5(e907) I; sEx11307. Show Description
sEx11307 [rCes T05A7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| AD319 |
C. elegans |
spe-38(syb6556[spe-38::wrmScarlet-I]) I; him-5(e1490) V. Show Description
wrmScarlet-I tag inserted into endogenous spe-38 locus. Him. wrmScarlet-I expression labels membranous organelles (MOs) in the sperm. Reference: Zuo Y, et al. Biomolecules. 2023; 13(4):623. https://doi.org/10.3390/biom13040623
|
|
| BP75 |
C. elegans |
eff-1(hy21) II. Show Description
Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperatures, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. sd-4%. ME=0. ES=3. OA-1 (oj55: complete embryonic and partial post-embryonic epithelial fusion failure). Cloned: encodes a type-I membrane glycoprotein with a single TM domain.
|
|
| BP76 |
C. elegans |
eff-1(hy21) II; jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperature, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. ME=0. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
|
|
| CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
| CGC136 |
C. elegans |
mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
|
|
| CGC137 |
C. elegans |
mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
|
|
| CGC152 |
C. elegans |
mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
| CGC153 |
C. elegans |
mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
| CGC159 |
C. elegans |
mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
|
|
| CGC161 |
C. elegans |
mir-266(umn68[mir-266p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
| CGC162 |
C. elegans |
mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
| CGC163 |
C. elegans |
mir-271(umn70[mir-271p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
| CGC164 |
C. elegans |
mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
| CGC165 |
C. elegans |
mir-784(umn72[mir-784p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
| CGC166 |
C. elegans |
mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
| CGC167 |
C. elegans |
mir-787(umn74[mir-787p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
|
|
| CGC168 |
C. elegans |
mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
|
|
| CGC170 |
C. elegans |
mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
|
|
| CGC172 |
C. elegans |
mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
|
|
| CGC177 |
C. elegans |
lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
|
|
| CGC180 |
C. elegans |
mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
|
|
| GLW53 |
C. elegans |
egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.
|
|
| GLW79 |
C. elegans |
sod-5(utx61[mScarlet-I-C1::3xMyc::sod-5]) II. Show Description
N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.
|
|
| GLW85 |
C. elegans |
pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. Show Description
N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.
|
|
| GLW89 |
C. elegans |
ubql-1(utx69[mScarlet-I-C1::3xMyc::ubql-1]) I. Show Description
N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.
|
|
| GLW91 |
C. elegans |
hrpa-1(utx71[hrpa-1::mScarlet-I-C1::3xMyc]) IV. Show Description
C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.
|
|
| GLW93 |
C. elegans |
clic-1(utx73[mScarlet-I-C1::3xMyc::clic-1]) V. Show Description
N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.
|
|
| GT330 |
C. elegans |
aSi8 II; unc-119(ed3) III. Show Description
aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT332 |
C. elegans |
aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR] II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|
| GT337 |
C. elegans |
aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST] II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|
| GT347 |
C. elegans |
aSi23 II; unc-119(ed3) III. Show Description
aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT350 |
C. elegans |
aSi26 II; unc-119(ed3) III. Show Description
aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT372 |
C. elegans |
aSi31 II; unc-119(ed3) III Show Description
aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT375 |
C. elegans |
aSi27 II; unc-119(ed3) III. Show Description
aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT377 |
C. elegans |
aSi36 II; unc-119(ed3) III. Show Description
aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| JWW253 |
C. elegans |
wrdSi3 II; ifet-1(dfw16[ifet-1::mScarlet-I::AID*::3xFlag]) III. Show Description
mScarlet-I::AID*::3xFlag tags inserted at the C-terminus of the endogenous ifet-1 locus. wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. ifet-1 visualized by mScarlet in oocytes with inducible acute degradation when grown on 4mM auxin. No defect in hermaphrodite embryo viability. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.
|
|
| LP896 |
C. elegans |
unc-94(cp439[unc-94::mNG-C1]) I; cap-1(cp436[mScarlet-I-C1::cap-1]) IV. Show Description
mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.
|
|
| MLC1480 |
C. elegans |
lucIs39. Show Description
lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| NL4807 |
C. elegans |
unc-119(ed3) III; pkIs2170 X. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
|
|
| RG3372 |
C. elegans |
hmg-11(ve872[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 452 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCAGAATGAGTGGAGAAGTTGGATCCA ; Right flanking sequence: ACTGGAGAGAAGAAGGGACGTGGACGCCCA. hmg-11 sgRNA #1: ACGAATGCCTTGTTTCTACC; hmg-11 sgRNA #2: CAAAGCAGCAAGAGCCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RW11085 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10934. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10934 [hmg-11::H1-wCherry + unc-119(+)].
|
|
| TH184 |
C. elegans |
unc-119(ed3) III; ddIs101. Show Description
ddIs101 [hmg-11::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| TV24781 |
C. elegans |
wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy1292[*wy1052])X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into N-terminus of endogenous syd-2 locus with (517-836) region deleted. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV24783 |
C. elegans |
wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy1052[GFP::syd-2]) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV24785 |
C. elegans |
wyIs891 III; elks-1(wy1232[FLPon::mScarlet-I::elks-1]) IV; syd-2(wy1052[GFP::syd-2]) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous elks-1 locus. GFP tag inserted into endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV24786 |
C. elegans |
wyIs891 III; cla-1(wy1233[cla-1::FLPon::mScarlet-I]) IV; syd-2(wy1052[GFP::syd-2]) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous cla-1 locus. GFP tag inserted into endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV24919 |
C. elegans |
wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy5) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV25205 |
C. elegans |
rab-3(wy1332[mScarlet-I::FLPon::rab-3B]) II; wyIs891 III; syd-2(wy1052[GFP::syd-2]) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
