| VT1160 |
C. elegans |
unc-119(ed3) III; maIs138. Show Description
maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.
|
|
| VT1189 |
C. elegans |
unc-119(ed3) III; maIs140. Show Description
maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.
|
|
| VT1259 |
C. elegans |
unc-119(ed3) III; maIs150. Show Description
maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.
|
|
| VT1289 |
C. elegans |
mir-63(n4568) X. Show Description
Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| VT132 |
C. elegans |
sqt-1(sc13) lin-29(n333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate more animals which are slightly shorter than WT, Rollers which are Egl and have a protruding vulva, and DpyUncs.
|
|
| VT1343 |
C. elegans |
flh-1(bc374) IV. Show Description
|
|
| VT1361 |
C. elegans |
mir-2(n4108) I. Show Description
Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| VT1362 |
C. elegans |
mir-70(n4109) V. Show Description
Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| VT1376 |
C. elegans |
flh-2(bc375) III. Show Description
|
|
| VT1379 |
C. elegans |
unc-119(ed3) III; maIs162. Show Description
maIs162 [mir-59p::GFP + unc-119(+)]. Wild type.
|
|
| VT1380 |
C. elegans |
unc-119(ed3) III; maIs163. Show Description
maIs163 [mir-357-358p::GFP + unc-119(+)]. Wild type.
[10/01/2018: Received new stock from VT following report from user that GFP expression pattern in original stock was not as expected.]
|
|
| VT1470 |
C. elegans |
unc-119(ed3) III; maIs173. Show Description
maIs173 [mir-242p::GFP + unc-119(+)]. Wild type.
|
|
| VT1474 |
C. elegans |
unc-119(ed3) III; maIs177. Show Description
maIs177 [mir-243p::GFP + unc-119(+)]. Wild type.
|
|
| VT1477 |
C. elegans |
unc-119(ed3) III; maIs180. Show Description
maIs180 [mir-244p::GFP + unc-119(+)]. Wild type.
|
|
| VT1479 |
C. elegans |
unc-119(ed3) III; maIs182. Show Description
maIs182 [mir-251p::GFP + unc-119(+)]. Wild type.
|
|
| VT1481 |
C. elegans |
unc-119(ed3) III; maIs184. Show Description
maIs184 [mir-51::GFP + unc-119(+)]. Wild type.
|
|
| VT1482 |
C. elegans |
unc-119(ed3) III; maIs185. Show Description
maIs185 [mir-2p::GFP + unc-119(+)]. Wild type.
|
|
| VT1485 |
C. elegans |
unc-119(ed3) III; maIs188. Show Description
maIs188 [mir-228p::GFP + unc-119(+)]. Wild type.
|
|
| VT1486 |
C. elegans |
unc-119(ed3) III; maIs189. Show Description
maIs189 [mir-54-56p::GFP + unc-119(+)]. Wild type.
|
|
| VT1488 |
C. elegans |
unc-119(ed3) III; maIs191. Show Description
maIs191 [mir-235p::GFP + unc-119(+)]. Wild type.
|
|
| VT1492 |
C. elegans |
unc-119(ed3) III; maIs196. Show Description
maIs196 [mir-227-80p::GFP + unc-119(+)]. Wild type.
|
|
| VT1494 |
C. elegans |
unc-119(ed3) III; maIs197. Show Description
maIs197 [mir-234p::GFP + unc-119(+)]. Wild type.
|
|
| VT1503 |
C. elegans |
unc-119(ed3) III; maIs206. Show Description
maIs206 [mir-81p::GFP + unc-119(+)]. Wild type.
|
|
| VT1539 |
C. elegans |
unc-119(ed3) III; maIs218. Show Description
maIs218 [mir-231p::GFP + unc-119(+)]. Wild type.
|
|
| VT1541 |
C. elegans |
unc-119(ed3) III; maIs220. Show Description
maIs220 [mir-360p::GFP + unc-119(+)]. Wild type.
|
|
| VT1555 |
C. elegans |
mir-59(n4604) IV. Show Description
Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT1598 |
C. elegans |
unc-119(ed3) III; maIs227. Show Description
maIs227 [mir-90p::GFP + unc-119(+)]. Wild type.
|
|
| VT1600 |
C. elegans |
unc-119(ed3) III; maIs229. Show Description
maIs229 [mir-85p::GFP + unc-119(+)]. Wild type.
|
|
| VT1605 |
C. elegans |
unc-119(ed3) III; maIs234. Show Description
maIs234 [mir-53::GFP + unc-119(+)]. Wild type.
|
|
| VT1607 |
C. elegans |
unc-119(ed3) III; maIs236. Show Description
maIs236 [mir-246p::GFP + unc-119(+)]. Wild type.
|
|
| VT1665 |
C. elegans |
unc-119(ed3) III; maIs251. Show Description
maIs251 [mir-1p::GFP + unc-119(+)]. Wild type.
|
|
| VT1673 |
C. elegans |
unc-119(ed3) III; maIs256. Show Description
maIs256 [mir-247-797p::GFP + unc-119(+)]. Wild type.
|
|
| VT1702 |
C. elegans |
unc-119(ed3) III; maIs261. Show Description
maIs261 [mir-265p::GFP + unc-119(+)] Wild type.
|
|
| VT1709 |
C. elegans |
unc-119(ed3) III; maIs267. Show Description
maIs267 [mir-266p::GFP + unc-119(+)]. Wild type.
|
|
| VT1710 |
C. elegans |
unc-119(ed3) III; maIs268. Show Description
maIs268 [mir-259p::GFP + unc-119(+)]. Wild type.
|
|
| VT1733 |
C. elegans |
unc-119(ed3) III; maIs276. Show Description
maIs276 [mir-60p::GFP + unc-119(+)]. Wild type.
|
|
| VT1735 |
C. elegans |
unc-119(ed3) III; maIs278. Show Description
maIs278 [mir-788p::GFP + unc-119(+)]. Wild type.
|
|
| VT1842 |
C. elegans |
unc-119(ed3) III; maIs300. Show Description
maIs300 [mir-82p::GFP + unc-119(+)]. Wild type.
|
|
| VT1891 |
C. elegans |
flh-3(tm3024) IV. Show Description
tm3024 deletion was generated by S. Mitani. Outcrossing was performed by M. Ow.
|
|
| VT191 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf1/szT1 X. Show Description
|
|
| VT192 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-6(e14) lin-14(n536) maDf2/szT1 X. Show Description
|
|
| VT1997 |
C. elegans |
maIs105 V; alg-1(ma192) X. Show Description
Maintain at 20C. maIs105 [col-19::GFP] V. ma192 is a S750F substitution mimicking human AGO1 S750F mutation. Adult ma192 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.
|
|
| VT2020 |
C. elegans |
unc-119(ed3) III; maIs347. Show Description
maIs347 [mir-793p::GFP + unc-119(+)]. Wild type.
|
|
| VT2021 |
C. elegans |
unc-119(ed3) III; maIs348. Show Description
maIs348 [mir-794p::GFP + unc-119(+)]. Wild type.
|
|
| VT2084 |
C. elegans |
unc-119(ed3) III; maIs352. Show Description
maIs352 [mir-71p::GFP + unc-119(+)]. Wild type.
|
|
| VT2392 |
C. elegans |
mir-34(gk437) X. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT2527 |
C. elegans |
mir-124(n4255) IV. Show Description
Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT2595 |
C. elegans |
mir-83(n4638) IV; mir-34(gk437) X. Show Description
DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT2797 |
C. elegans |
pat-3(st564)/qC1 [dpy-19(e1259) glp-1(q339)] III; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Heterozygotes are superficially WT (with DTC migration defects), and segregate superficially WT (with DTC migration defects), sterile ts-Dpy qC1 homozygotes, and st564 homozygotes (PAT lethal). Pick WT and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
| VT2812 |
C. elegans |
unc-54(e190) I; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Paralyzed. DTC migration defect. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|