Homozygous viable. Deletion of 2424 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTTCAGAAGAACTGCTTCTGGGAAATGG; Right flanking sequence: GATATTGTTGGTACTCTCCACGAGCTGGAT. sgRNA #1: GATAACCAAAAGTGTCGTGG; sgRNA #2: CATTTCCTTGCAAGCCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4236 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATAGGAGACGTCCGGATTTGTCGATGGA; Right flanking sequence: CGGTTTTCTGGGATTTCTTCGGGAATTTCT. sgRNA #1: GAATCGTGTACGGTGTGTGG; sgRNA #2: TCTCTTTTCGATTTAATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTAAACAGTGCCACTATCCCCATCCG; Right flanking sequence: TGGGCGTTTAATTTGAAAGAATTGAGTAAA. sgRNA #1: TTCTCAAAGGTCCCTTGTGG; sgRNA #2: TTCTTTCAATGGGTGCTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1914 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTTCGAATTTTTGAATTTTGTCACCT; Right flanking sequence: AGGATCTCGAGCTTTTGTTTTTTTTTTCAA. sgRNA #1: GAAAAGAGACTTATACAGGC; sgRNA #2: ACATTTCTCAACTCGTCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGCACGAATCTACAAACATTTTATTTT; Right flanking sequence: TGGCCCATAATTATGGGGCTCGAGTTGCTC. sgRNA #1: GCAATAGTTCTCAGTTCTCA; sgRNA #2: ACAGAGATTTTACTTCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7082 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7082 and CGC66. hd7082 is a 525 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGGGAATTTGTTGTCTATTGCAAATCCA; Right flanking sequence: CGGACCAGTGGTTGCTCCGAGGTTGTTCAC. sgRNA #1: AAGGCTTTATATCCCGGTGG; sgRNA #2: CCGTCAATGGCCAAAGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1797 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTAAATTAGAAATATTCTAGTTTTAGG; Right flanking sequence: TGGAAGATGAGCAGAAGTTTGAAGAAGATT. sgRNA #1: TATTGTTCATCGATGATGGC; sgRNA #2: AGTTGTGCCGAAGAATATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAAATACGAAGACTACGGAAACTACATTAT; Right flanking sequence: AGGTCTTGGATCAACGAATGAATTGGCTTT. sgRNA #1: TTCAGAACTAATGGGCGGAG; sgRNA #2: ACTGCATTCATGACTCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTCTTGCGCTTAGCACCGCCCATTTTAAA; Right flanking sequence: AGACCCATGCAGAGAAACTGCTTGTGCCTT. sgRNA #1: ATCAATCAGCGAACTTTTGG; sgRNA #2: CTCCACGATCTCAGCTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2010 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACGGAAACCATACGTTGAAGCCTTTCCA; Right flanking sequence: TGGCAAAGCATCATCACTTATTCCAGAAAT. sgRNA #1: GAAGATGTTGCTTCACTTGG; sgRNA #2: CTTCTTTTAGTCCATCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4130 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTGCTGCTTCTACTGCCCCCGTGTCCCG; Right flanking sequence: TGGAATAAGACGTGTCAGCTCCATATCTGT. sgRNA #1: CCGTCCAAATCTCACGTCAC; sgRNA #2: AAAGTTTCTACATCCTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7087 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7087 and CGC66. hd7087 is a 442 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7098 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7098 and CGC66. hd7098 is a 5984 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7099 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7099 and CGC92. hd7099 is a 1508 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7083 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7083 and CGC66. hd7083 is a 1871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7091 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7091 and CGC66. hd7091 is a 5126 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7109 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7109 and CGC66. hd7109 is a 472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAATAGCTTACTATTAGCTAGAAAATCCG; Right flanking sequence: GAGCGGCCATATTTAGACAGTTTTTTTGGTTCT. sgRNA #1: GGTTGGAATTGAGGAACGTT; sgRNA #2: TTCGAGCGGAGTCCATGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCGGAGACACTACACCTTCGAGACTCCT; Right flanking sequence: TGGTGCTCAATGTGCAGTGGCGTTTGGCTC. sgRNA #1: TCTTCAGTATATCCATTCGG; sgRNA #2: CGACTTGACGCTCATCGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7100 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7100 and CGC66. hd7100 is a 572 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7101 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7101 and CGC66. hd7101 is a 1562 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 900 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACAGATCTACACAATCCTGGAGCTCCT; Right flanking sequence: AGGCTCATTTTTGAAGCCGAATTTTACTAA. sgRNA #1: CACGAACATCTAGCTCCCTC; sgRNA #2: CTCCACTCGCCAAGGATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7124 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7124 and CGC66. hd7124 is a 3032 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTATCAATGCTTTTTTATTGTGTGACAAGA; Right flanking sequence: CGCGAAAAATTCCAGGTTTTTTCCCATTTT. sgRNA #1: TTCGCGTGAGAGTTAGAAGC; sgRNA #2: CTCCATTGACAATCGTCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7125 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7125 and CGC66. hd7125 is a 1024 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATCACATTCAAATCGAATCGTTCCTTCGAC; Right flanking sequence: TCCTTCTCCAAATCTTCTTATTATCCGTGT. sgRNA #1: TCGAGCGGCAGATTTCCCGG; sgRNA #2: AAACGAAAAACGCCATTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7127 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACAGTACTCTTTAAAGGCTCTCAATCTTGT; Right flanking sequence: TGGAAAAGCAGACAAAAAAGGCGAGAAGAA. sgRNA #1: CATTCTACAAAAATGTATCG; sgRNA #2: GTGATTCGTACCTCACATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7101 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTTTGCCTCAGAGTAATAATAAGCTAAACA; Right flanking sequence: GGGATTCAAATCTTGATGTCAATCTTGAAA. sgRNA #1: TTTTAACCCCTCATCACAAG; sgRNA #2: CATTAAGAGTTAAATTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7162 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTACACCTTCTCTAATGACATTTCCACCG; Right flanking sequence: TATTATCAGCTGCTGATACAGATAAAAGGA. sgRNA #1: AATCCAATGAATGCATCAGC; sgRNA #2: ACTACATCACAGACTGTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3086 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAAGAAGCTTTTCAACCACCCGCCTCCCT; Right flanking sequence: AGGACACATTATGGAGCCACCATACTTCCC. sgRNA #1: GTTATCAATCACACGACTGG; sgRNA #2: CAGGTTGAACTAGTGAATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 14229 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATAAGGAGCAGAATGTCTTTCCATTGGA; Right flanking sequence: AGGACATGCTTTTCATGCTGAAATCCGACG. sgRNA #1: GCAATTTGACGAGTTTCGGG; sgRNA #2: AAAAGTCAAGATTGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 15206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTATGGTAGGTCTTTCAAGCCTGCGTGCCT; Right flanking sequence: CTTTGGGTCACCTTATGAGACATGACCGGT. sgRNA #1: TAGAAAACTAGTCATGAGGG; sgRNA #2: CGCTGAGGGATCAATGTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGCAGGGAAATGGATTTATGCCCGATGGT; Right flanking sequence: AGGTCCGCAAAACCCCAGGAAAAAAGTCTA. sgRNA #1: TCATCGAGATTCACATGCAA; sgRNA #2: AGCTACTAGAACTTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1516 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACTTGTACAGTCGAGACTGGCTCACACCA; Right flanking sequence: CTGCAGTTGATGATCAACCCGAGAATGTTC. sgRNA #1: AGAATTGTCAGCATTCCAGC; sgRNA #2: TGGTCAGAATCTCTTCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGAGGAAGCTGATTAAATTTTCGAAATG; Right flanking sequence: CGACTTTATAAAAGCCGTTGTACCATATTT. sgRNA #1: GGCCACTATGTTATAGTCGG; sgRNA #2: CCATCGTTCTATACTCCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1144 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTACAGTTCACAATCGCGTCACACCC; Right flanking sequence: GGGGACAAGCTGAGCTATGCAGATTATGCT. sgRNA #1: CGAAAATATAATCGGGTTAG; sgRNA #2: ACGGCGAAAACTTTGTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGGAGCTCGTCAACGATGAAAATTCTGCCA; Right flanking sequence: ACCTCTTATGCAATTCCAAAACAATTTTCT. sgRNA #1: GGAAACAACTTCAACATGGG; sgRNA #2: GACAGATGGCCTCAGTTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.

Homozygous viable. Deletion of 1154 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCATCTTTTATATGCAAATATATTCCT; Right flanking sequence: CGTATGTGAAAGAATATGGAGAGGATCGGG. sgRNA #1: CATTATAAATTGTGGAAGGG; sgRNA #2: ATGCTTCAATCGTTGCTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATCAAATTCATTTTTGGATCAATCGGTT; Right flanking sequence: TGGGTTATTCATAAGGTGTGAGTCCCAAAA. sgRNA #1: GTTTTAGGAGCACATCACGG; sgRNA #2: ATCATCACGGCAGACACAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCTACATTCAGGGGTGTTTTTTCATATCT; Right flanking sequence: CGGCAATTGTCGCAAAAAATTTGGTGTGAC. sgRNA #1: CAAAGCTATGATGTGGTCCA; sgRNA #2: GCCAGCGTCTGTTAGAGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7144 and CGC92. hd7144 is a 5280 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTGAAGAATAGCAGCAAAAACGGTCACCT; Right flanking sequence: ATTACTTTTTTTTAAAAAGTACAGTATCAA. sgRNA #1: ACAGGTGTTTACAATGCGAG; sgRNA #2: TATTTTCTTACAGTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7147 and CGC63. hd7147 is a 7691 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCAATTCTTCAATTTTTCCAATTCTTC; Right flanking sequence: TCTTTTCTGGTCGACAAAGGTGCCTAAATC. sgRNA #1: ATAAAGTGAAGATTGGTGGG; sgRNA #2: AACAGTGTTTTGGGGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGTTCAAAGGCAAGCACATTGGCGCGGC; Right flanking sequence: TGGAATATATTATTCAAAAACGACAATTGC. sgRNA #1: GACCGCCCGTCTCGAGACAT; sgRNA #2: TTCAGAATGAGTTCAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACGATGGAACCATCACCAGACGGTCAACT; Right flanking sequence: TTTTCTCATTTTTCTCATCGTCGATGCATT. sgRNA #1: CGAGATAATCGCAAATTCAG; sgRNA #2: CCACATATGTTATCAAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGTGGACGGTTTTGTGGGCATAATGCAT; Right flanking sequence: CCACTCCCCTTTTTCGGAAATTGGAAAACG. sgRNA #1: CACATTTCACGCACAGAAGA; sgRNA #2: TGAACGAAAGATTAACGGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.