More Fields
Strain Species Genotype
ZG686 C. elegans unc-119(ed3) III; egl-9(sa307) V; iaEx101. Show Description
iaEx101 contains [egl-9p::egl-9(H487A)::tag + unc-119(+)]. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZH1963 C. elegans enIs59 I; unc-76(e911) V. Show Description
enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187
ZH231 C. elegans enIs7 X. Show Description
enIs7 [ced-1p::ced-1::GFP + unc-76(+)] X. GFP marker for cell corpses. Reference: Lu N, et al. Methods Mol Biol 2009;559, 357-370. PMID: 19609769
ZH2486 C. elegans enIs74 II; unc-76(e911) V. Show Description
enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.
ZH382 C. elegans unc-108(n3263) I. Show Description
Recessive Unc. Recessive apoptotic cell removal defect. Recessive phagosome maturation defect (inefficient and prolonged phagosome maturation process in embryos). Reference: Mangahas PM, Yu X, and Zhou Z. J Cell Biol. 2008 Jan 28;180(2):357-73.
ZM10176 C. elegans unc-25(e156) III; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10206 C. elegans hpIs758. Show Description
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Weak myo-2 and AVA Cherry expression. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10281 C. elegans hpIs740. Show Description
hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10311 C. elegans unc-25(e156) III; ljIs131; hpIs758. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10339 C. elegans hpIs717; ljIs131. Show Description
hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10393 C. elegans hpIs592; hpIs595. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10410 C. elegans gbb-2(tm1165) IV; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10441 C. elegans unc-49(e407) III; hpIs592; ljIs131. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10484 C. elegans unc-25(e156) III; hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10743 C. elegans unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10823 C. elegans hpIs596; hpIs268. Show Description
hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
ZM10829 C. elegans hpEx4271. Show Description
hpEx4271 [gbb-2(fosmid)::GFP + myo-2p::RFP]. Pick animals with red fluorescence to maintain. GBB-1::GFP expression in muscles and neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM11006 C. elegans ljIs131; hpEx4340. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.
ZM11020 C. elegans ljIs131; hpEx4343. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.
ZM1157 C. elegans daf-2(e1370) III; juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM1344 C. elegans hpIs61 II. Show Description
hpIs61 [unc-25p::unc-10::GFP]. hpIs61 maps to LG II.
ZM1385 C. elegans hpIs66. Show Description
hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM2246 C. elegans hpIs88. Show Description
hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM2960 C. elegans nca-2(gk5) III; unc-77(gk9) IV. Show Description
Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.
ZM3087 C. elegans unc-9(fc16) unc-7(e5) X. Show Description
Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM4366 C. elegans hpIs157. Show Description
hpIs157 [glr-1p::YC3.60 + lin-15(+)]. Strong fluorescent marker for inter-neuron/head motor neuron Ca2+ imaging (FRET). Construct includes 5.3 kb glr-1 genomic promoter sequence upstream of the ATG start codon. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460
ZM4624 C. elegans hpIs166. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.
ZM4864 C. elegans daf-2(e1370) III; oxIs22. Show Description
oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM4898 C. elegans hpIs171. Show Description
hpIs171 [acr-2p::D3cpv + lin-15(+)]. Strong fluorescent marker for motor neuron Ca2+ imaging (FRET). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460
ZM5043 C. elegans hpIs190. Show Description
hpIs190 [nmr-1p::D3cpv + lin-15(+)]. Strong fluorescent marker for Ca2+ imaging (FRET) AVA, AVE, AVD, RIM and a few other neurons. Construct includes 5.1 kb nmr-1 genomic promoter sequence upstream of the ATG start codon but a excludes a 2 kb fragment encoding cex-1 that interferes with calcium imaging (Kawano and Zhen, unpublished observation). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460
ZM5101 C. elegans hpIs193. Show Description
hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043
ZM5132 C. elegans hpIs179. Show Description
hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM54 C. elegans hpIs3 X. Show Description
hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.
ZM5488 C. elegans hpIs202. Show Description
hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM588 C. elegans fsn-1(hp1) III; juIs1 IV; scd-2(ok565) V. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.
ZM607 C. elegans syd-2(ok217) X. Show Description
Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
ZM6523 C. elegans hpDf761 II; unc-119(ed3) III. Show Description
hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM6539 C. elegans unc-39(hp701) V. Show Description
Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM6665 C. elegans hpIs268. Show Description
hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Strain allows calcium imaging for D-motor neurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
ZM6686 C. elegans hpIs289. Show Description
hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6725 C. elegans hpIs290. Show Description
hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6804 C. elegans hpIs270. Show Description
hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
ZM7054 C. elegans hpIs321. Show Description
hpIs321 [nmr-1p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neurons ablation (AVA/AVE/AVD/others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM7055 C. elegans hpEx2999. Show Description
hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919
ZM7212 C. elegans unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7297 C. elegans hpIs331. Show Description
hpIs331 [lgc55Bp::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation (AVB & others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM7419 C. elegans hpIs363. Show Description
hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM7465 C. elegans hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM7646 C. elegans unc-77(gk9); nca-2(gk5); hpIs166; hpEx3197. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7648 C. elegans unc-77(gk9); nca-2(gk5); hpIs166; hpEx3195. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.