iaEx101 contains [egl-9p::egl-9(H487A)::tag + unc-119(+)]. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187

enIs7 [ced-1p::ced-1::GFP + unc-76(+)] X. GFP marker for cell corpses. Reference: Lu N, et al. Methods Mol Biol 2009;559, 357-370. PMID: 19609769

enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.

Recessive Unc. Recessive apoptotic cell removal defect. Recessive phagosome maturation defect (inefficient and prolonged phagosome maturation process in embryos). Reference: Mangahas PM, Yu X, and Zhou Z. J Cell Biol. 2008 Jan 28;180(2):357-73.

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Weak myo-2 and AVA Cherry expression. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press).

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.

hpEx4271 [gbb-2(fosmid)::GFP + myo-2p::RFP]. Pick animals with red fluorescence to maintain. GBB-1::GFP expression in muscles and neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.

hpIs61 [unc-25p::unc-10::GFP]. hpIs61 maps to LG II.

hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.

hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.

Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.

Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

hpIs157 [glr-1p::YC3.60 + lin-15(+)]. Strong fluorescent marker for inter-neuron/head motor neuron Ca2+ imaging (FRET). Construct includes 5.3 kb glr-1 genomic promoter sequence upstream of the ATG start codon. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460

hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.

oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.

hpIs171 [acr-2p::D3cpv + lin-15(+)]. Strong fluorescent marker for motor neuron Ca2+ imaging (FRET). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460

hpIs190 [nmr-1p::D3cpv + lin-15(+)]. Strong fluorescent marker for Ca2+ imaging (FRET) AVA, AVE, AVD, RIM and a few other neurons. Construct includes 5.1 kb nmr-1 genomic promoter sequence upstream of the ATG start codon but a excludes a 2 kb fragment encoding cex-1 that interferes with calcium imaging (Kawano and Zhen, unpublished observation). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460

hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043

hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.

hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.

Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).

hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.

Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Strain allows calcium imaging for D-motor neurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.

hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.

hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.

hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035

hpIs321 [nmr-1p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neurons ablation (AVA/AVE/AVD/others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035

hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919

hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.

hpIs331 [lgc55Bp::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation (AVB & others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035

hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).

hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.

hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.