VC4141 |
C. elegans |
nipa-1(gk5224[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3485 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAAAAAAGAACAAAAACTGGGTGAGGATC ; Right flanking sequence: ATACCCATAACCGCCTTCCGATGCCCGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4143 |
C. elegans |
ptr-21(gk5226[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3539 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCATCGGATCAAGTATTTGGAAGAAGCAC ; Right flanking sequence: CTCAGTTGGCCTAGCGACCGCTTCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4144 |
C. elegans |
C50D2.2(gk5227[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAACGTGTATTTCGTCTGAAAAACTTGCCG ; Right flanking sequence: GGAGGAAAACTTCGATTCAGCATTCCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4147 |
C. elegans |
F23F1.6(gk5230[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCATGAAGACATTGATGAGTAGACCAAGG ; Right flanking sequence: TCAAATGTCTTTTTACGAAACAAGACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4148 |
C. elegans |
ptr-20(gk5231[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3301 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAAGCACTCGGTGAAGTTTCGCAGGCTCA. Right flanking sequence: TCGTACTAATGTCCCTTCTAGTGTTGGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC415 |
C. elegans |
gem-4(gk222) IV. Show Description
T12A7.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4151 |
C. elegans |
ptr-15(gk5234[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2870 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATGAGAGTGCATACGACCCAGAATACAAT. Right flanking sequence: CCTCGGTTCGCATATTCAGAATACCGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4152 |
C. elegans |
gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
[NOTE: Please see RG5044 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2546 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC. Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4155 |
C. elegans |
gbh-2(gk5238[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTGTATCAGGTTTCACATGGGTTACCG ; Right flanking sequence: CAGGGAAGTCACAAACTTCTTTATGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4156 |
C. elegans |
R12C12.6(gk5239) II; clec-56(gk5240) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5239 mutation is A->T, flanking sequences AAATTTTAAAAGACTCGGACAAATGCATCG and CATCGTGTATCTTCGAAGTTAGCCTGAAAA. The gk5240 mutation is G->A, flanking sequences ATGCTGACACCAATCACTGCCCTCTTGGAT and GACCTTCTCCACCAATACTTCTTACTGTTA.
|
|
VC4157 |
C. elegans |
glct-4(gk5241) I; C05D2.8(gk5242) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT.
|
|
VC4158 |
C. elegans |
AH9.1(gk5243) K09C4.10(gk5244) X. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC.
|
|
VC4159 |
C. elegans |
lbp-9(gk5245[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAGAAACATGCCAATTCAAACCGATCTT ; Right flanking sequence: ACGGAGTCAAGTGCACTCGCGTCTACGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4160 |
C. elegans |
ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4162 |
C. elegans |
smg-4(gk5248[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTTGGATGATTGGACGTAGTTGCACGA. Right flanking sequence: GCAGGATGAAAATAGGTTCCAATGACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4163 |
C. elegans |
Y53F4B.12(gk5249[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3837 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCTTCATTATTCTACCCTTCTCACTAAC ; Right flanking sequence: GGTCTACCTTCAACACTACTACCCGGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: The correct genotype of this strain is Y53F4B.12(gk5249). The strain was incorrectly identified as Y53F4B.13 when this strain was sent to the CGC.]
|
|
VC4164 |
C. elegans |
mab-20(gk5250[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGAGAATTGGGAGACACCGGCTCCAGAC ; Right flanking sequence: TAAAATTAAACGTCGGATCCACAACACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4167 |
C. elegans |
C56C10.9(gk5253[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCCAACTTACATCGTTCACTTCCTTCG ; Right flanking sequence: GATGGGTCGAGATTGTGGGAAAATATCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4168 |
C. elegans |
ZK1251.3(gk5254[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 708 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGACTTTGTCAAACACGGAAAAACCATTA ; Right flanking sequence: GTTTGGTAGAGGAGAAAGAGTTCCATTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC417 |
C. elegans |
magu-2(gk218) V. Show Description
C01B7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4170 |
C. elegans |
F52H2.7(gk5256[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3426 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACCTGTATGACAAGGAGACGAACTAAAAC ; Right flanking sequence: TCTGGAAATGTAGATAATTATTCTTCGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4171 |
C. elegans |
lgc-33(gk5257[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTACTACCACTCGGCGGTGAGGCCCGCCG ; Right flanking sequence: CTCTAATGGATCTCTGGTTGTGTGCCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4174 |
C. elegans |
gkDf69[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] V. Show Description
Homozygous viable. Deletion of 7975 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGTCTGATTATCAATTGAAACCTTTG ; Right flanking sequence: CAAAGGTTTCAATTGATAATCAGACTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4177 |
C. elegans |
fipr-3(gk5263) K09E3.5(gk5264) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5263 mutation is G->A, flanking sequences TTTTTCGTATTTTCAATTTCCAATGTTTCA and CCTTCTTTGTGTCCTTGCCTTGGTCATGTG. The gk5264 mutation is G->A, flanking sequences ATCTTCTTACCTTTGCTCCTTTCGGAGCTT and ATCTTCCCAGCTGATTTCCCTGGCCATAGA.
|
|
VC4178 |
C. elegans |
W03G9.2(gk5265) I; C34F11.1(gk5266) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC.
|
|
VC418 |
C. elegans |
him-3(gk149) IV/nT1 [qIs51] (IV;V). Show Description
ZK381.1. Homozygous viable deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP gk149 homozygotes (strongly Him, with small broods and many arrested embryos). nT1[qIs51] homozygotes inviable. Pick GFP WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4181 |
C. elegans |
clec-91(gk5267) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5267 mutation is C->T, flanking sequences AATGCGCTGGTGCCAAGATCCTTGTGGTCC and AGTTGTAGTATGTCACTGTAAGATTGATTA.
|
|
VC4182 |
C. elegans |
nol-16(gk5268) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5268 mutation is G->A, flanking sequences TGCTCATTGATTCATAATTTTGAATTTTCA and AAAGAGATCATCGACGCGGAGCCAATTGAC.
|
|
VC4183 |
C. elegans |
M03D4.4(gk5269[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2613 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTTGAGGTGAAGCTCCAGAAGAACTCG ; Right flanking sequence: GGTGGTCTCGCTCGCGCAACGACATGGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4187 |
C. elegans |
ubc-8(gk5273[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4189 |
C. elegans |
K03H1.13(gk5275[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1796 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGAAAACACGATATTTGATTTGAAAGCA ; Right flanking sequence: GATTCATCCGTTACAACTTCTATAGATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC419 |
C. elegans |
nhr-67(ok631) IV/nT1 [qIs51] (IV;V). Show Description
C08F8.8. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok631 homozygotes (Unc, probable L1 arrest). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4194 |
C. elegans |
W02B12.12(gk5279[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCCATGGCAAAGCAAGGCAATCGGTTGAT ; Right flanking sequence: TGTGGACTTTTTTTCGAGAAAAAAAATAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4195 |
C. elegans |
ist-1(gk5280[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 6442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAGAGTACGTTGAGACAATGTTTGACGC ; Right flanking sequence: GACTAAAGAAGAGCTGGCATACTAAGGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4197 |
C. elegans |
syp-1(gk5282[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTTCACAATTTGGGTTGACGCTCCCACTG. Right flanking sequence: CAGCCAAGTGTAGAAGTTACTCCAGTACAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC42 |
C. elegans |
qua-1(gk32)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T05C12.10. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk32 homozygotes (early larval arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4203 |
C. elegans |
ptr-19(gk5288[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 4684 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGTGATCATCGAAGATAGAATATTGGGGA; Right flanking sequence: TAGTGATATTGGTAGACGAGGTCCTTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4204 |
C. elegans |
glb-15(gk5289[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGTTTTATTTACGCCATAAAAACCTGCC ; Right flanking sequence: ATGGATGGGCGTTGAAGACGTCTGACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4205 |
C. elegans |
Y71H2AM.20(gk5290[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4206 |
C. elegans |
nbs-1(gk5291[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTTTTTATTCACACGGTATATTGGGAGCAT. Right flanking sequence: TCTTTCAACACATAAACCTCTAGAAGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4207 |
C. elegans |
ugt-6(gk5292[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGTGTTTTACCATCAGATCAGTTGGCGTG ; Right flanking sequence: GATGGAATATGCTGCCTTCCAAGTTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4209 |
C. elegans |
C29F9.8(gk5294) III; fbxa-139(gk5295) V. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.
|
|
VC4210 |
C. elegans |
frpr-2(gk5296) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5296 mutation is G->A, flanking sequences ATAGAGGGGTACGCGGGAGTTGCCAATCTG and TAAGTATACTGAAAACCCTAGTTTTCGAGG.
|
|
VC4211 |
C. elegans |
C03B1.1(gk5297) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5297 mutation is C->T, flanking sequences TTGTACGACGAGTCATGCTGTGTTGGAGCC and GAGGTCGTGATGTCTATCTAAATTTCGGTC.
|
|
VC4212 |
C. elegans |
C56A3.8(gk5298) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5298 mutation is G->A, flanking sequences ATAATTTTAAGGAAAAAATTAAATTTTTCA and AAACTTTTCCGTCACGGAATCGCTAGCTCC.
|
|
VC4213 |
C. elegans |
tsp-19(gk5299) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5299 mutation is G->A, flanking sequences AAAAGTCATATAATGACATATGTAAACCCG and TGAGTGACGGATTGAATGAAGTCCATTATC.
|
|
VC4214 |
C. elegans |
D2005.4(gk5300) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5300 mutation is G->A, flanking sequences AATCTTGATTTTAAATGCGAACGATTTTCA and GGCGAAGACTACAATGTGCAGCAGGCAAAA.
|
|
VC4215 |
C. elegans |
F42F12.3(gk5201[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1066 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGTTTTGATTTTAAAGGTATTCCGATG ; Right flanking sequence: ATCGGCATCTAATTTCTAATGCTTCAAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4217 |
C. elegans |
oac-56(gk5303[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCATGTCATCTGGCCTAGTTACAGCGTAGT ; Right flanking sequence: ATTGGATGTCTTCTCGCATTGTGGTAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC422 |
C. elegans |
tag-120(gk221) V. Show Description
F40F9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|