Search Strains

More Fields
Strain Species Genotype Add
XE2263 C. elegans oyIs14 V; wpEx369. Show Description
oyIs14 [sra-6p::GFP] V. wpEx369 [sra-6p::mito::TagRFP + odr-1p::RFP]. Maintain by picking animals with red fluorescence. PVQ neurons are marked with integrated GFP marker. Mitochondria in PVQ neurons are visualized with sra-6p::mito::TagRFP. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. doi: 10.7554/eLife.73557. PMID: 35285800.
XE2374 C. elegans casy-1(wp60) II; oyIs14 V. Show Description
oyIs14 [sra-6::GFP + lin-15(+)] V. wp60 is an allele of casy-1, the C. elegans homolog of calsyntenin. Reference: Ding C, et al. eLife. 2022 Mar 14;11:e73557. doi: 10.7554/eLife.73557. PMID: 35285800.
XE2411 C. elegans unc-116(rh24sb79) III; oyIs14 V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. sb79 is an intragenic suppressor of the rh24 gain-of-function allele. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
XE2660 C. elegans wpIs40 V; ynIs50. Show Description
wpIs40 [unc-47p::mCherry] V. ynIs50 [flp-22p::GFP]. AVL neurons are labeled with GFP and mCherry. Can be used to isolate AVL by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XE2789 C. elegans pha-1(e2123) III; ccIs4595 IV; wpEx482. Show Description
ccIs4595 [ceh-24::GFP + rol-6(su1006)]. wpEx482 [ceh-17::NLS::TagRFP + pha-1(+)]. Maintain at 25C to retain array. GFP expression in vulval muscles, m8, and set of neurons in the head. The four SIA neurons are marked with both GFP and RFP. Can be used to isolate SIA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XE2795 C. elegans ric-7(wp127[ric-7::gfp11x7]) V. Show Description
wp127 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous ric-7 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: Wu Y, et al. bioRxiv [Preprint]. 2023 Jul 12:2023.07.12.548706. doi: 10.1101/2023.07.12.548706. Update in: J Cell Biol. 2024 May 6;223(5): PMID: 37502914.
XE2835 C. elegans wpIs39 X; otIs92. Show Description
wpIs39 [unc-47p:mCherry] X. otIs92 [flp-10::GFP]. DVB neurons are marked with GFP and mCherry. Can be used to isolate DVB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XE2839 C. elegans mtx-2(wy50266) III; miro-1(wy50180) IV; oyIs14 V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
XE3004 C. elegans pha-1(e2123) III; wpEx505. Show Description
wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). The ocr-3p::mEGFP plasmid used to generate this strain was provided by Dr. Patrick Laurent.
XE3088 C. elegans pha-1(e2123) III; wpEx517. Show Description
wpEx517 [srab-20p::Neptune2.5 + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Neptune2.5 expression in PHB neuron can be used to isolate PHB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XE3106 C. elegans pha-1(e2123) III; otIs707; wpEx525. Show Description
otIs707 [bnc-1p(1.8kb)::GFP]. wpEx525 [nlp-38p::NLS::TagRFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. GFP expression in VA neurons can be used to isolate VA by FACS (exclude TagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XE3354 C. elegans unc-40(wp221) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. wp221 is a CRISPR-engineered deletion of unc-40 exon 14.5 near the splice sites of exons 14 and 15. mec-4p::GFP is expressed in touch neurons. Reference: Weinreb A, et al. Nat Commun. 2025 May 16;16:4508. doi: 10.1038/s41467-025-58293-5. PMID: 40379606.
XF110 C. elegans polk-1(lf29) III. Show Description
Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
XF132 C. elegans polh-1(lf31) III. Show Description
Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
XF503 C. elegans lfIs129. Show Description
lfIs129 [elt-2p::GFP-HReporter + rol-6(su1004) + P(HS)::ISceI::mCherry]. Rollers. Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
XF86 C. elegans unc-119(ed3) III; pkIs2379 pkIs2170. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. pkIs2379 [hsp-16.41::I-Sce-I ORF + rol-6(su1006)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
XIL9106 C. elegans bar-1(thu106[bar-1::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous bar-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9112 C. elegans mab-5(thu112[mab-5::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous mab-5 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9115 C. elegans Y56A3A.18(thu115[Y56A3A.18::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous Y56A3A.18 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9119 C. elegans sup-37(thu119[sup-37::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous sup-37 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9122 C. elegans ztf-14(thu120[ztf-14::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-14 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9126 C. elegans cbp-1(thu126[cbp-1::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous cbp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9127 C. elegans nhr-67(thu127[nhr-67::LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP]) IV. Show Description
LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9129 C. elegans nhr-34(thu129[nhr-34::H1::mCherry]) IV. Show Description
H1::mCherry was inserted at the 3' end of the endogenous nhr-34 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9136 C. elegans ztf-7(thu136[ztf-7::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-7 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9137 C. elegans sma-3(thu137[sma-3::2A::H1::mCherry]) III. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous sma-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9138 C. elegans ceh-33(thu138[ceh-33::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ceh-33 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9139 C. elegans F57C9.4(thu139[F57C9.4::2A::H1::mCherry]) I. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous F57C9.4 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9140 C. elegans F57A8.1(thu140[H1::GFP::2A::F57A8.1]) V. Show Description
H1::GFP::2A was inserted at the 5' end of the endogenous F57A8.1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9152 C. elegans saeg-2(thu152[saeg-2::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous saeg-2 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9164 C. elegans daf-3(thu164[daf-3::SL2::mCherry::H2B]) X. Show Description
SL2::mCherry::H2B was inserted at the 3' end of the endogenous daf-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9172 C. elegans Y53G8AR.9(thu172[pes-1::2A::NeonGreen::H2B]) III. Show Description
2A::NeonGreen::H2B was inserted at the 3' end of the endogenous pes-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL9222 C. elegans hnd-1(thu22[H1::mCherry::2A::hnd-1]) X. Show Description
2A::H1::mCherry was inserted at the 5' end of the endogenous hnd-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL933 C. elegans Y53G8AR.9(thu33[Y53G8AR.9::mCherry]) III. Show Description
mCherry was inserted at the 3' end of the endogenous Y53G8AR.9 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL949 C. elegans tlp-1(thu49[tlp-1::SL2::H1::mCherry]) IV. Show Description
SL2::H1::mCherry was inserted at the 3' end of the endogenous tlp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XIL99 C. elegans vab-15(thu9[vab-15::GFP]) X. Show Description
GFP was inserted at the 3' end of the endogenous vab-15 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
XK194 C. elegans unc-46(e177) let-479(s1576) V/nT1 [qIs51] (IV;V). Show Description
XM1002 C. elegans vab-1(dx31) III; itr-1(sy290) unc-24(e138) IV. Show Description
vab-1 null and itr-1 gain of function. Viable. Unc.
XM1003 C. elegans nmr-1(ak4) II; fog-2(q71) V. Show Description
Negative regulator of oocyte maturation. Male/female strain.
XM1007 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); unc-43(n498) IV. Show Description
Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.
XM1011 C. elegans inx-22(tm1661) I. Show Description
Negative regulator of oocyte maturation.
XM1012 C. elegans inx-22(tm1661) I; fog-2(q71) V. Show Description
Negative regulator of oocyte maturation. Male/Female strain.
XMN1253 C. elegans daf-15(bgg95) IV. Show Description
Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.
XR1 C. elegans abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
XR2 C. elegans ced-3(n717) IV; abl-1(ok171) X. Show Description
XR3 C. elegans lagr-1(gk327) I; hyl-1(ok976) IV. Show Description
XR4 C. elegans lagr-1(gk327) I; hyl-1(ok976) IV; abl-1(ok171) X. Show Description
XR5 C. elegans lagr-1(gk327) I; hyl-1(ok976) IV; ced-3(n717) IV. Show Description
XR6 C. elegans lagr-1(gk327) I; opIs219. Show Description
opIs219 contains [ced-4p::ced-4::GFP].
XR7 C. elegans gld-1(op236) I; hyl-1(ok976) IV. Show Description