| NL132 |
C. elegans |
pgp-1(pk17) IV. Show Description
pgp-1 deletion allele. No visible phenotype. Might be sensitive to drugs.
|
|
| NL1586 |
C. elegans |
dpy-20(e1282) IV; pkIs523. Show Description
pkIs523 [gpa-7(+) + dpy-20(+)].
|
|
| NL1607 |
C. elegans |
dpy-20(e1282) IV; pkIs587. Show Description
pkIs587 [gpa-10::GFP + dpy-20(+)].
|
|
| NL1609 |
C. elegans |
dpy-20(e1282) IV; pkIs589. Show Description
pkIs589 [gpa-13::GFP + dpy-20(+)]. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
| NL161 |
C. elegans |
pkEx589. Show Description
pkEx589 [mrp-1::lacZ + rol-6(su1006)]. Rollers. Maintain by picking Rol.
|
|
| NL1610 |
C. elegans |
dpy-20(e1282) IV; pkIs590. Show Description
pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.
|
|
| NL1800 |
C. elegans |
mut-16(pk700) I. Show Description
|
|
| NL1810 |
C. elegans |
mut-16(pk710) I. Show Description
|
|
| NL1820 |
C. elegans |
mut-7(pk720) III. Show Description
Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.
|
|
| NL1832 |
C. elegans |
T24C4.1(pk732) III. Show Description
|
|
| NL1834 |
C. elegans |
mut-9(pk734) Show Description
Mutator.
|
|
| NL1838 |
C. elegans |
mut-14(pk738) Show Description
Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.
|
|
| NL1909 |
C. elegans |
acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
|
|
| NL1925 |
C. elegans |
acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
|
|
| NL2001 |
C. elegans |
gpb-2(pk751) I. Show Description
Flanking sequence: AGTCACTCTT - deletion - GAAGACTACT.
|
|
| NL2328 |
C. elegans |
dpy-20(e1282) IV; pkIs1269. Show Description
pkIs1269 [gpa-13XS(+) + dpy-20(+)].
|
|
| NL2330 |
C. elegans |
gpa-13(pk1270) V. Show Description
|
|
| NL2334 |
C. elegans |
dpy-20(e1282) IV; pkIs1273. Show Description
pkIs1273 [gpa-16::GFP + dpy-20(+)].
|
|
| NL242 |
C. elegans |
mut-2(r459) I; flp-1(pk41::Tc1) IV. Show Description
TTTAAAACG TA CTTACCTTT
|
|
| NL243 |
C. elegans |
mut-2(r459) I; ZK637.13(pk42) III. Show Description
insertion: TTCTGTGAAC TA TGTCAAAAT
|
|
| NL244 |
C. elegans |
nhr-2(pk43::Tc1) mut-2(r459) I. Show Description
Dpyish.
|
|
| NL245 |
C. elegans |
mut-2(r459) I; elt-2(pk46::Tc1) X. Show Description
Insertion in GGTCAAACG TA AGTTAAAGT.
|
|
| NL2507 |
C. elegans |
pkIs1582. Show Description
pkIs1582 [let-858::GFP + rol-6(su1006)]. Rollers.
|
|
| NL332 |
C. elegans |
gpa-1(pk15) V. Show Description
|
|
| NL3400 |
C. elegans |
pkIs1604. Show Description
pkIs1604 [hsp-16.2::ATG(A)17GFP::LacZ + rol-6(su1006)]. Rollers.
|
|
| NL3401 |
C. elegans |
pkIs1605. Show Description
pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
|
|
| NL3531 |
C. elegans |
rde-2(pk1657) I. Show Description
Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat. AKA mut-8.Mutator. Flanking sequence: cctatgatcatattattgacgactttagtc aatggcaaagaaagagtttttaaatgtcat.Mutator.
|
|
| NL3630 |
C. elegans |
pkIs32 III; eri-1(mg366) IV. Show Description
pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
|
|
| NL3643 |
C. elegans |
unc-22(st136) IV. Show Description
Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.
|
|
| NL3908 |
C. elegans |
unc-119(ed3) III; pkIs1641. Show Description
pkIs1641[unc-119(+)]. Non-Unc strain.
|
|
| NL3909 |
C. elegans |
unc-119(ed3) III; pkIs1642. Show Description
pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.
|
|
| NL4000 |
C. elegans |
sma-1(e30) V. NL subclone of CB4000. Show Description
NL subclone of CB4000. High Tc1 copy number strain. See WBG 14(4): 16-17.
|
|
| NL4110 |
C. elegans |
prg-1 (pk2298) I. Show Description
Superficially wildtype.
|
|
| NL4266 |
C. elegans |
nucb-1(pk1654) Show Description
|
|
| NL4517 |
C. elegans |
alg-2(ok304) II; pkIs2256. Show Description
pkIs2256 [alg-2::HA + rol-6(su1006)]. Rollers.
|
|
| NL4609 |
C. elegans |
C27H5.7(pk1745) II. Show Description
Right flanking sequence of Tc1: 5'-TATATTCCAGAAA.
|
|
| NL4807 |
C. elegans |
unc-119(ed3) III; pkIs2170 X. Show Description
pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.
|
|
| NL5117 |
C. elegans |
ppw-2(pk1673) I. Show Description
|
|
| NL545 |
C. elegans |
dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.
|
|
| NL665 |
C. elegans |
mut-6(st702) IV. Show Description
|
|
| NL706 |
C. elegans |
mut-2(r459) cap-1(pk56::Tc1) I. Show Description
|
|
| NL708 |
C. elegans |
mut-2(r459) I; cct-1(pk58::Tc1) II. Show Description
TTCTCACA TA ATTCCGATCT. Somewhat Dpyish.
|
|
| NL711 |
C. elegans |
mut-2(r459) I; feb-1(pk61). Show Description
|
|
| NL712 |
C. elegans |
mut-2(r459) I; sem-2(pk64). Show Description
|
|
| NL713 |
C. elegans |
mut-2(r459) I; sox-2(pk65). Show Description
K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.
|
|
| NL714 |
C. elegans |
mut-2(r459) I; sox-3(pk66). Show Description
F40E10.2. Location of the insertion: ATTAATAATA TA ACTATTGAAA.
|
|
| NL721 |
C. elegans |
cdh-3(pk77) III. Show Description
ZK112.7. Insertion sequence: TGGAGATACG TA GGTTTTTGAT.
|
|
| NL723 |
C. elegans |
mpk-1(pk79) mut-2(r459) I. Show Description
|
|
| NL726 |
C. elegans |
mut-2(r459) I; kin-18(pk71) III. Show Description
T17E9.1
|
|
| NL728 |
C. elegans |
cey-1(pk81) II. Show Description
Tc1 allele.
|
|
