Search Strains

oxTi922 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:8.58). Intragenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi940 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.56). Insertion into C06A8.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi983 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-14.58). Insertion into src-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX5520 with CA1200. Reference: https://www.biorxiv.org/content/10.1101/2023.09.18.558239v1.

mgEx779 [lipl-4p::K04A8.5p::lipl-4::SL2::GFP + myo-2p::mCherry]. Polycistronic translational fusion; GFP and LIPL-4 expressed separately. Pick animals with red pharynx to maintain. Reference: Wang et al. Science. 2008 Nov 7;322(5903):957-60.

aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

This strain can grow at 11.5C but is embryonic lethal at 15C and above. Temperature shifts in late embryogenesis or in larval stages result in defects in many asymmetric cell divisions in postembryonic develoment.

Temperature sensitive. At 22.5C, maternal effect embryonic lethal. Temperature shift-up to 22.5C during embryogenesis results in animals with Egl, Pvul and Psa (phasmid socket absent) phenotypes. Shift-up to 25C results in growth arrest at larval stage. The T cell division can be symmetric as in lin-17 mutants. At 15C, nearly WT. Males grown at 15C can mate very well. psa-1 encodes a homolog of yeast SW13, a component of the SWI/SNF complex. Sequence data of this strain revealed the mutation is actually GTC/CCC/TCA to GTC/CTC/TCA causing a P86L substitution (G. Hayes).

Maintain at 20C. Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.

Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of mes-2 between II:14388297...14388298. Reference: Paix A, et al. Genetics. 2014 Sep 23.

tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.

tagRFP tag inserted into endogenous gtbp-1 locus. meGFP tag inserted between P121 and V122 of endogenous MEG-3. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.

Null allele of wago-10. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous alg-1 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous alg-2 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous ergo-1 locus; specifically tags a-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous prg-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous rde-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous wago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous sago-2; specifically tags c-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous sago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous nrde-3 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

3xFLAG tag inserted into endgonenous nrde-3 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

3xFLAG tag inserted into endgonenous wago-10 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

3xFLAG tag inserted into endgonenous wago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

3xFLAG tag inserted into endgonenous vsra-1/C04F12.1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

N2 with integrated array pJH4.52. xsIs3[hisH2B::GFP; rol-6(su1006)]. 39.9.1 Must be kept at 25C to avoid germline-silencing.

Temperature sensitive allele of let-418. Viable at 20C. Sterile and partially Muv at 22.5C. Larval lethal at 25C.

jsSi1623 [loxP::mex-5p::phiC31::SL2::mNG::glh-2 3’ FRT3] IV. Transgene expresses phiC31 and mNG in the germline, facilitates integration of extrachromosomal arrays at high efficiency. Reference: Nonet ML. bioRxiv 2024.03.01.583017.

jsSi2682 [attP mex-5p::FLP::SL2::mNeonGreen::UTR Cbr-unc-119(+) attL::mex-5Kp::phiC31] IV. Inserted at cxTi10882 on IV. Transgene expressing FLP and phiC31 recombinases and mNG in the germline for performing Recombination Mediated Insertion (RMI) transgenesis and Recombination Mediated Homolog Exchange (RMHE). Reference: Nonet ML. bioRxiv 2024.03.01.583017.

otEx4767 [trp-1p(1.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.

otEx4804 [twk-13p(2.5kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.

otEx7947 [W02A2.5p::GFP + pha-1(+)]. I3 neurons are labeled with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.

A4e enhancer was deleted in endogenously-tagged cfi-1(kas16[mNG::AID*::cfi-1]). Expression of cfi-1::mNG::AID* is lost in VNC motor neurons. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.

Eight COE motifs in A4e were mutated in endogenously-tagged cfi-1(kas16[mNG::AID*::cfi-1]). Expression of cfi-1::mNG::AID* is down-regulated in late larval stages and adults. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID*, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206.

syEx1712[T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.

syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs852 [C50F7.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.

fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

T22H2.5a Homozygous. Outer Left Sequence: aactagaagaaatgggcggg. Outer Right Sequence: catttttgtgcaagctcacg. Inner Left Sequence: ttaacaaggaaatgtgggcg. Inner Right Sequence: ccagaactttcctcctgctg. Inner Primer PCR Length: 2122. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C37A2.5a. Homozygous. Outer Left Sequence: TTGTGGTTCGGTGTGTGTTT. Outer Right Sequence: TGGTTCTGTGCTGAAAGACG. Inner Left Sequence: GGGAGAGGATGCAACAAAGA. Inner Right Sequence: TGCTCCAGCTTTGAGGATTT. Inner primer WT PCR product: 2940. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

stIs11797 [C37A2.5a::H1-wCherry + unc-119(+)].

stIs11816 [F54F2.5b::H1-wCherry + unc-119(+)].

stIs11952 [F29F11.5a::H1-wCherry + unc-119(+)].

gaIs228 [C26B9.5p::his-24::mCherry + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10373 [C50F7.5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).