| XIL9152 |
C. elegans |
saeg-2(thu152[saeg-2::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous saeg-2 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9164 |
C. elegans |
daf-3(thu164[daf-3::SL2::mCherry::H2B]) X. Show Description
SL2::mCherry::H2B was inserted at the 3' end of the endogenous daf-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9172 |
C. elegans |
Y53G8AR.9(thu172[pes-1::2A::NeonGreen::H2B]) III. Show Description
2A::NeonGreen::H2B was inserted at the 3' end of the endogenous pes-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9222 |
C. elegans |
hnd-1(thu22[H1::mCherry::2A::hnd-1]) X. Show Description
2A::H1::mCherry was inserted at the 5' end of the endogenous hnd-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL933 |
C. elegans |
Y53G8AR.9(thu33[Y53G8AR.9::mCherry]) III. Show Description
mCherry was inserted at the 3' end of the endogenous Y53G8AR.9 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL949 |
C. elegans |
tlp-1(thu49[tlp-1::SL2::H1::mCherry]) IV. Show Description
SL2::H1::mCherry was inserted at the 3' end of the endogenous tlp-1 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL99 |
C. elegans |
vab-15(thu9[vab-15::GFP]) X. Show Description
GFP was inserted at the 3' end of the endogenous vab-15 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XMN1253 |
C. elegans |
daf-15(bgg95) IV. Show Description
Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.
|
|
| XR1 |
C. elegans |
abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
|
|
| XR5 |
C. elegans |
lagr-1(gk327) I; hyl-1(ok976) IV; ced-3(n717) IV. Show Description
|
|
| XT3 |
C. elegans |
cln-3.3(gk118) V. Show Description
Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT4 |
C. elegans |
cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT5 |
C. elegans |
cln-3.2(gk41) I; cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT2. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT6 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) V. Show Description
Made as model for Batten disease. Derived from XT2 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XT7 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Decreased brood size, mild life-span reduction. Made as model for Batten disease. Derived from XT2 and XT4. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
| XW13734 |
C. elegans |
unc-76(e911) V; qxIs612. Show Description
qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.
|
|
| XW18042 |
C. elegans |
qxIs722 II. Show Description
qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.
|
|
| XW19180 |
C. elegans |
qxIs750. Show Description
qxIs750 [hsp-16.2p::nuc-1::pHTomato::unc-54 3'UTR + hsp-16.41p::nuc-1::pHTomato::unc-54 3'UTR + odr-1p::GFP]. Heat-shock inducible pHTomato transgene for monitoring lysosomal activity. Reference: Sun Y, et al. Elife. 2020 Jun 2:9:e55745. doi: 10.7554/eLife.55745. PMID: 32482227.
|
|
| XW5399 |
C. elegans |
unc-76(e911) V; qxIs257. Show Description
qxIs257 [ced-1p::nuc-1::mCherry + unc-76(+)]. Integrated nuc-1::mCherry transgene marking lysosomes in epidermal cells. Site of chromosomal integration unknown. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.
|
|
| XW8056 |
C. elegans |
unc-76(e911) V; qxIs430. Show Description
qxIs430 [scav-3::GFP + unc-76(+)]. Integrated GFP translational fusion transgene marking lysosomes in epithelial cells. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.
|
|
| XY1054 |
C. elegans |
cep-1(lg12501) I. Show Description
1213 bp deletion corresponding to bp 30458-31670 on cosmid F52B5. Takes out a large part of the cep-1 open reading frame.
|
|
| XZ2065 |
C. elegans |
hif-1(ia4) V; yakEx131. Show Description
yakEx131 [eft-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a ubiquitous promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx131 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2083 |
C. elegans |
hif-1(ia4) V; yakEx145. Show Description
yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2084 |
C. elegans |
hif-1(ia4) V; yakEx125. Show Description
yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2085 |
C. elegans |
hif-1(ia4) V; yakEx146. Show Description
yakEx146 [vha-6p::hif-1(cDNA) + dpy-7p::hif-1(cDNA) + rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-, hypodermal-, and intestinal-specific promoters in hif-1 mutant background for tissue-specific rescuing experiments. yakEx146 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| YA1059 |
C. elegans |
trt-1(ok410) I. Show Description
Becomes very sick if starved for extended periods of time or if frozen and thawed repeatedly. Primer sequences provided by the C. elegans Reverse Genetics Core Facility for ok410 are: Outer Left Sequence: AAGACTGTCAGCTGGTGGGT. Outer Right Sequence: TTAGCCTTACATTGCCGCTT. Inner Left Sequence: TCATGCGCAACATCTAAAGC. Inner Right Sequence: CGAATAAAGCAATTTCCCGA. Inner primer WT PCR product: 2825.
|
|
| YE57 |
C. elegans |
smc-5(ok2421)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.
|
|
| YE59 |
C. elegans |
smc-5(tm2868)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm2868 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. tm2868 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.
|
|
| YHS2 |
C. elegans |
cdc-25.1(bn115) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, et al. (2009) Mol Cell 28:43-8.
|
|
| YHS25 |
C. elegans |
cdc-25.2(ok597) V/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok597 homozygotes (Emo, Ste). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, Kawasaki I, Shim Y. (2010) J Cell Sci 123:993-1000.
|
|
| YL139 |
C. elegans |
meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
| YL140 |
C.elegans |
meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
| YL195 |
C. elegans |
pzf-1(vr3) V. Show Description
Superficially wild type.
|
|
| YL398 |
C. elegans |
unc-119(ed3) III; vrIs55. Show Description
vrIs55 [ges-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
| YL402 |
C. elegans |
unc-119(ed3) III; vrIs56. Show Description
vrIs56 [pie-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
| YL409 |
C. elegans |
unc-119(ed3) III; vrIs60. Show Description
vrIs60 [lin-35p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
| YL418 |
C. elegans |
unc-119(ed3) III; vrIs65. Show Description
vrIs65 [ges-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
| YL425 |
C. elegans |
unc-119(ed3) III; vrIs69. Show Description
vrIs69 [dpl-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
|
|
| YL445 |
C. elegans |
unc-119(ed3) III; vrIs81. Show Description
vrIs81 [pie-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
| YL468 |
C. elegans |
unc-119(ed3) III; vrIs93. Show Description
vrIs93 [mex-5p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
| YL585 |
C. elegans |
oef-1(vr25) IV. Show Description
vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.
|
|
| YM19 |
C. elegans |
cpb-3(bt17) I. Show Description
Slightly slow growth. Almost sterile at 25C. Grow at 15-20C.
|
|
| YQ243 |
C. elegans |
unc-119(ed3) III; atg-18(gk378) V; wfIs232. Show Description
wfIs232 [app-1p::mCherry::H2B::unc-54 + unc-119(+)]. mCherry::H2B expression in the nuclei of intestinal cells. YQ243 can serve as a control strain for YQ95. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
|
|
| YQ95 |
C. elegans |
unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
|
|
| YX9 |
C. elegans |
lin-15(n675) X; ahIs1. Show Description
ahIs1 [myo-3p::NpHR::eCFP + lin-15(+)]. Muscle specific expression of halorhodospin. In the presence of all-trans-retinol, worms are paralyzed upon light stimulation. Weak CFP expression in muscles. Reference: Faoud AD, et al. Elife. 2018 Jan 23:7:e29913. doi: 10.7554/eLife.29913. PMID: 29360037.
|
|
| YY11 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi. Sterile at 25 degrees. Referenced in Pavelec et al. Genetics (2009).
|
|
| YY13 |
C. elegans |
rrf-3(mg373) II; oxls12. Show Description
oxls12 [unc-47p::GFP + lin-15(+)]. Enhanced RNAi. Sterile at 25 degrees. [NOTE: the genotype of YY13 as previously annotated only as rrf-3(mg373)] References: Pavelec DM, et al. Genetics. 2009 Dec;183(4):1283-95. PMID: 19797044. McIntire SL, et al. Nature. 1997 Oct 23;389(6653):870-6. PMID: 9349821.
|
|
| YY1325 |
C. elegans |
wago-4(gg620[3xflag::gfp::wago-4]) II. Show Description
3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
| YY156 |
C. elegans |
nrde-2(gg95) II. Show Description
Reference: Guang S, et al. Nature. 2010 Jun 24;465(7301):1097-101.
|
|
| YY178 |
C. elegans |
ggIs1. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)]. Unknown if unc-119 is still in background. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
|
|