Strain Information
| Name | MAA1 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ari-2(ama1) IV. |
| Description | ari-2(ama1) is a CRISPR-engineered null allele replacing nearly all of the coding sequence with an insertion of stop codons in every frame (TAGATAAATGA). CRISPR edit was performed with dpy-10 co-CRISPR (Arribere, Bell et al. 2014). crRNAs (5': 5'- AGACATGAGCTGCACGTCCG; 3': 5'- AGTCGAAGAGCTCGCATGGG). Single-stranded repair template contained an insertion of stop codons in every frame (TAGATAAATGA) and 35bp homology on both sites. Generated in N2 background. Reference: Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | M. Armakola |
| Laboratory | MAA |
| Reference | Armakola M, et al. 2026 Mar 11;46(10):e0509252026. doi: 10.1523/JNEUROSCI.0509-25.2026. PMID: 41651665. |
Sign in
or
register an account if you want to order this strain.