Strain Information
| Name | BAN580 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | C03B8.3(bon104) III; mcu-1(ju1154) IV; tag-321(bon105) IV. |
| Description | tag-321(bon105) is a CRISPR/Cas9-engineered 1.1 kb deletion in mcu-1(ju1154) mutant background, replicating the tag-321(bon103) lesion. The resulting double mutant was crossed with C03B8.3(bon104) males to generate the triple mutant. tag-321(bon105) genotyping primers: GGTTGTTTTCCAGTCAAATCCCTCTCAC and GCACATTGAAGTTTTGAGCAAATAACAGGG; WT: ~1330 bp; bon103: ~160 bp. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Bano Lab |
| Laboratory | BAN |
| Reference | Vetralla M. et al, doi: 10.1038/s41467-025-67647-y |
Sign in
or
register an account if you want to order this strain.