Strain Information
| Name | BAN545 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | C03B8.3(bon104) III. |
| Description | C03B8.3(bon104) is a CRISPR/Cas9-engineered 5 kb deletion. Genotyping primers: GATGTACGCTCACGCGAAAAATACG and AGCAAGAAGAGATCAAAACCATTTAATCACCAC. WT: ~5 kb; bon103: ~280 bp. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x4 |
| Made by | Bano Lab |
| Laboratory | BAN |
| Reference | Vetralla M. et al, doi: 10.1038/s41467-025-67647-y |
Sign in
or
register an account if you want to order this strain.