Strain Information

Name BAN544   View On Wormbase
Species C. elegans
Genotypetag-321(bon103) IV.
Descriptiontag-321(bon103) is a CRISPR/Cas9-engineered 1.1 kb deletion. Genotyping primers: GGTTGTTTTCCAGTCAAATCCCTCTCAC and GCACATTGAAGTTTTGAGCAAATAACAGGG; WT: ~1330 bp; bon103: ~160 bp. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045.
MutagenCrispr/Cas9
Outcrossedx5
Made byBano Lab
Laboratory BAN
Reference Vetralla M. et al, doi: 10.1038/s41467-025-67647-y
Sign in or register an account if you want to order this strain.