Rearrangement Information

NamesC4 View on WormBase
DescriptionGrowth characteristics: Homozygous inviable. Average brood size 117. Cause of homozygous lethal phenotype unknown. unc-76 - rol-9 genetic distance reduced to 1.8%. Recommended use: General balancing. Handling: Easy to manipulate. Heterozygous males mate well. Summary: Dominant crossover suppressor, uncharacterized with regard to structure, moderately stable. Balances right portion of LG V from rol-9 to unc-76.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
BC4586 unc-76(e911) rol-9(sc148)/sC4(s2172) [dpy-21(e428)] V. C. elegans Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%.
RG3104 cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. C. elegans Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.