| FX30197 |
tmC25 IV. |
C. elegans |
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) One breakpoint is in unc-8, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
| FX30203 |
tmC25 [unc-5(tmIs1241)] IV. |
C. elegans |
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
| FX30257 |
tmC25 [unc-5(tm9708)] IV. |
C. elegans |
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
| RG3115 |
vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)]. |
C. elegans |
Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615). |
| RG3187 |
Y41D4A.6(ve687[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 |
C. elegans |
Homozygous sterile. Deletion of 4404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve687 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ATTTCGGCGCTGTTCCAGACGCTGTCGGCG ; Right flanking sequence: aggcactgtgcgcagttttggttcccgcaa. sgRNA #1: TGACAATCAAATCGACTTCC; sgRNA #2: caattttctagaatttccca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3191 |
lem-4(ve691[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. |
C. elegans |
Homozygous sterile, Pvl. Deletion of 5370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve691 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: tctcttttcagctggaaactgtaaactcct ; Right flanking sequence: TGGGCGATTTTAGCATATCTTCCATGGAAT. sgRNA #1: ttatttaacttcctatctca; sgRNA #2: aactcacTTATACAAGTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3193 |
cct-8(ve693[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. |
C. elegans |
Homozygous larval lethal. Deletion of 5958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve693 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CACGTGGTTTTGGTCCTCCAGTCGCCTGCT ; Right flanking sequence: CGGTTCCTTTGAAGTGCTGAGCTCCTTCCT. sgRNA #1: TCAGATTATTATGTCAAAGC; sgRNA #2: GCACTTCAAAGGAACCGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3197 |
Y54G2A.75(ve697[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. |
C. elegans |
Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |