| FX19666 |
tmC5 IV. |
C. elegans |
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
| FX30140 |
tmC5 [F36H1.3(tmIs1220)] IV. |
C. elegans |
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Balancer marked with myo-2p::Venus. Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241. |
| RG3134 |
czw-1(ve634[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. |
C. elegans |
Homozygous larval arrest. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Mec non-Unc arrested larvae (ve634 homozygotes) and non-GFP Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. |
| RG3150 |
copg-1(ve650[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. |
C. elegans |
Homozygous embryonic lethal. Deletion of 3667 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead eggs (ve650 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: caaatgttaaatttacattgtaaacctcgc ; Right flanking sequence: ttcgacaattgtgatgtatgtgtgttttaa. sgRNA #1: tacatacacagttggtcgcg; sgRNA #2: acatcacaattgtcgaacgc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3152 |
T20D3.5(ve652[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. |
C. elegans |
Homozygous sterile. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults(ve652 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: gatgcaattcaacaaatcaaattggaaggc ; Right flanking sequence: aactcaccggacgtataagtctaacttgat. sgRNA #1: caaatcaaattggaaggcgt; sgRNA #2: tatacgtccggtgagttcaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3159 |
ard-1(ve659[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC5 IV. |
C. elegans |
Homozygous sterile, Pvl. Deletion of 3031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Sterile Pvl (ve659 homozygotes) and Mec Unc animals (tmC5 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: cacttatgatttaggtaaacgggaacaaAT ; Right flanking sequence: ctccttgtactctgggatctatattcataa. sgRNA #1: aggtaaacgggaacaaATGT; sgRNA #2: tcccagagtacaaggagaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5001 |
qns-1(gk5611[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC5 IV. |
C. elegans |
Apparent homozygous lethal or sterile deletion balanced by tmC5. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, sterile GFP+ gk5611 homozygotes and non-GFP Mec Unc animals (tmC5 homozygotes). Maintain by picking fertile wild-type GFP+ and checking for proper segregation of progeny. Derived from parental strains VC4540 and FX19666. Left flanking sequence: GATAACTGAAATCTGGATAGAGGAATGGTC. Right flanking sequence: CCCAATTGTTGACTGTACATGTGGCAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |