Caenorhabditis Genetics Center (CGC)

Rearrangement Information

NamenT1 View on WormBase
DescriptionRecommended use: General balancing, strain maintenance, mutant screens. reciprocal translocation:right arm of IV and left arm of V; N300 Handling: Easy to manipulate. Heterozygous males mate well. Vulvaless homozygous hermaphrodites completely unable to mate. Cause of vulvaless phenotype unknown. Translocation may break down spontaneously, but analysis of such events is lacking. Heterozygous strains occasionally begin to segregate large numbers of sick-looking progeny while appearing to remain heterozygous, or they occasionally begin to give larger broods (Schein and Baillie, unpublished results). nT1[qIs51] carries an integrated pharyngeal GFP element, and is homozygous inviable; this variant appears to be transferred to male cross progeny more frequently than to hermaphrodite cross progeny. Summary: Translocation, moderately well characterized, very stable. Very effective balancer for right portion of LG IV from right end through unc-17, and for left portion of LG V from left end through unc-76.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
BC3318 sDf64 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3319 sDf65 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, lethal Uncs (arrest as L1) and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3320 sDf67 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3499 let-297(s1989) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed!
BC3840 sDf69(s2298) unc-22(s7) lev-1(x22)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC4006 sDf83 IV/nT1 [let-?(m435)] (IV;V). C. elegans sDf83 homozygotes arrest as late larva or sterile adults after 2 weeks.
BC4008 sDf85(s2089) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. sDf85 homozygotes arrest as embryos or early L1 larva. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BS3347 lin-45(dx84) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc heterozygotes, non-Unc Steriles (lin-45 homozygotes), larval lethals, and dead eggs. dx84 is a strong lin-45 raf allele: dx84 homozygotes from dx84/+ heterozygotes are 47% larval lethal and among the adults, 100% are Sterile and Vul.
BS5182 sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.
BS5183 lin-45(oz201) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals, and dead eggs. oz201 is a strong lin-45 raf allele: oz201 homozygotes from oz201/+ heterozygotes segregate 55% larval lethal and the remaining adults are all Sterile and Vul.
BW163 ctDf1 V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs (heterozygotes) and dead eggs (ctDf1 homozygotes or nT1 homozygotes).
CA1117 dsb-1(we11) IV/nT1[unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs (dsb-1 homozygotes), which produce 99% inviable embryos due to meiotic nondisjunction. Pick Unc to maintain and check for correct segregation of progeny. we11 is a TCA to TAA nonsense mutation in the dsb-1 coding sequence that introduces a premature stop after leucine 96. Reference: Stamper EL, et al. PLoS Genet. 2013;9(8):e1003679.
CA649 ubc-9(tm2610) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs, and Pvul slow growing tm2610 homozygotes. Pick Unc to maintain and check for correct segregation of progeny. Reference: Bhalla N, et al. PLoS Genet. 2008 4(10) e1000235.
CB3616 tra-3(e1107) dpy-4(e1166)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Dpy, Vul, and dead eggs. The Dpys throw Dpy males. Maintain by picking WT.
CB3988 tra-3(e1107) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Hets are Unc and segregate Unc, WT hermaphrodites and dead eggs. The WT hermaphrodites segregate only abnormal sterile males or intersexes. Maintain by picking Unc.
CB5166 dif-1(e2562) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs, and WT (dif-1/dif-1). The WT animals give 100% dead eggs. dif-1 is a maternal effect embryonic lethal gene and e2562 is a putative null allele.
CB5378 unc-42(e270) let-560(e2658) V/nT1 (IV;V). C. elegans let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.
CB5535 hda-1(e1795) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, non-Unc Sterile Gon, and dead eggs.
CGC11 unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. C. elegans umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
CGC13 unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. C. elegans umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
CGC33 unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. C. elegans umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC39 unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. C. elegans umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC63 unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC71 unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. C. elegans umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CL6180 smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. C. elegans dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL691 dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
CV199 fan-1(tm423) IV/nT1 [qIs51] (IV;V). C. elegans Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP fan-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smogorzewska A, et al. (2010) Molec Cell 39:36-47.
CZ18637 juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). C. elegans juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ26660 micu-1(ju1155) IV/nT1 [qIs51] (IV;V). C elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
DA1042 egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) C. elegans Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat.
DA496 sDf10 unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.
DA497 let-59(s49) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine.
DA709 +/nT1 IV; sqt-3(sc63) eat-6(ad467) unc-76(e911)/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly.
DR1056 unc-42(e270) ama-2(m323) V/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. (Chromosome carrying unc-42 ama-2 is homozygous lethal.) Strain is resistant to _-amanitin.
DR1172 let-60(s59) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Lethal Twitchers, and dead eggs. Lethal mid-larval (leaky). Maintain by picking WT. Heterozygotes twitch in 1% nicotine.
DR1215 unc-22(s7) let-67(s214) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, dead eggs and Twitchers that arrest as larvae. Maintain by picking WT. Hets twitch in 1% nicotine.
DR520 sDf9/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, and lethals. Lethal early larval. Heterozygotes twitch in 1% nicotine. Well balanced.
DR561 sDf8/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and lethals. Lethal early larval. Heterozygotes twitch in 1% nicotine.
DR641 ama-1(m118m221) unc-8(e15)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are semi-Unc and segregate semi-Unc and Vul and dead eggs. (Does not segregate Unc homozygotes because linked to the unc is a lethal in the amanitin gene.)
DR682 dpy-13(e184) ama-1(m118m235) IV/nT1 [qIs51] (IV;V). C. elegans Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in mid-larval stages at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR683 dpy-13(e184) ama-1(m118m236)/nT1 IV; +/nT1 V. C. elegans Temperature sensitive . Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead eggs and Dpys. Dpys are sterile adults at 15C and 20C. Dpys are early larval lethals at 25C.
DR684 mDf9/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and dead eggs. Homozygous Df is embryonic lethal. Strain is sensitive to alpha-amanitin. New stock received from Patrice Albert 12/95. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
DR685 dpy-13(e184) ama-1(m118m238)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, Dpy and dead eggs. Dpys produce progeny at 15C and 20C, but are sterile at 25C. Strain is sensitive to alpha-amanitin.
DR697 cha-1(m324) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and Lethals.
DR699 dpy-13(e184) ama-1(m118m252)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are Dpy and segregate Dpy, Vul and dead eggs. Homozygous dpy-13 ama-1 animals are embryonic lethals. Strain is sensitive to alpha-amanitin.
DR732 daf-15(m81) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, Twitchers which are dauers (dauer constitutive) and dead eggs. Maintain by picking WT. Hets twitch in 1% nicotine.
DR787 dpy-13(e184) ama-1(m118) let-276(m240)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. Lethal early larval. Maintain by picking semi-Dpy.
DR789 dpy-13(e184) IV/nT1 [let-?(m435)] (IV;V); unc-42(e270) V/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
DR792 sDf2/nT1 IV; +/nT1 V. C. elegans Hets are WT and segregate WT, dead eggs and Vul (nT1/nT1). Clone WT to maintain. Well balanced. The nT1 homozygotes may overtake the plate at 15C or upon starvation.
DR793 dpy-13(e184) mDf7 IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are semi-Dpy and segregate semi-Dpy and dead eggs (mDf7/mDf7, nT1/nT1 and aneuploids). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 11/99 from Riddle lab.