Caenorhabditis Genetics Center (CGC)

Rearrangement Information

NamenT1 View on WormBase
DescriptionRecommended use: General balancing, strain maintenance, mutant screens. reciprocal translocation:right arm of IV and left arm of V; N300 Handling: Easy to manipulate. Heterozygous males mate well. Vulvaless homozygous hermaphrodites completely unable to mate. Cause of vulvaless phenotype unknown. Translocation may break down spontaneously, but analysis of such events is lacking. Heterozygous strains occasionally begin to segregate large numbers of sick-looking progeny while appearing to remain heterozygous, or they occasionally begin to give larger broods (Schein and Baillie, unpublished results). nT1[qIs51] carries an integrated pharyngeal GFP element, and is homozygous inviable; this variant appears to be transferred to male cross progeny more frequently than to hermaphrodite cross progeny. Summary: Translocation, moderately well characterized, very stable. Very effective balancer for right portion of LG IV from right end through unc-17, and for left portion of LG V from left end through unc-76.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
VC959 folt-1(ok1460) V/nT1 [qIs51] (IV;V). C. elegans C06H2.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1460 homozygotes (large, healthy sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC960 tag-335(ok1456) IV/nT1 [qIs51] (IV;V). C. elegans C42C1.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1456 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC964 tag-321&tag-322(ok1422) IV/nT1 [qIs51] (IV;V). C. elegans C33H5.10, C33H5.19. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1422 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WH108 abc-1(oj2) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs and abc-1 homozygotes. At 25C abc-1 homozygotes are sterile Unc animals. At 16C abc-1 homozygotes are fertile animals that produce all dead eggs.
WH556 mrck-1(ok586) V/nT1 [qIs51] (IV;V). C. elegans Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok586 homozygotes (Lvl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WM182 csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc. csr-1(tm892) homozygotes are non-Unc and Sterile.
WM214 avr-14(ad1302) I; csr-1(tm892)/nT1 [unc-?(n754) let-?] IV; avr-15(ad1051) glc-1(pk54))/nT1 V; axIs36 X. C. elegans axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM43 gex-3(zu196) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Zygotic phenotype: 100% of gex-3 homozygotes become Egl although they all make a normal looking L3/L4 vulva. Embryonic phenotype: complete loss of morphogenesis - hypodermal cells fail to intercalate or migrate. Received new stock from Erik Lundquist 11/2003.
WS5235 ccz-1(t2129) V/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
WU1854 pcn-1(am315[3xFLAG]) IV/nT1 [qIs51] (IV;V). C. elegans Homozygous maternal effect lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP am315 homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. 3xFLAG epitope allows antibody detection of full-length PCN-1. Reference: Kocsisova Z, et al. BMC Dev Biol. 2018 May 30;18(1):12.
XA6400 hlh-17(ok487) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+ in the pharynx. ok487 homozygotes arrest as early larvae and are GFP-. qIs51 homozygotes are inviable.
XK194 unc-46(e177) let-479(s1576) V/nT1 [qIs51] (IV;V). C. elegans
YHS25 cdc-25.2(ok597) V/nT1 [qIs51] (IV;V). C. elegans Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok597 homozygotes (Emo, Ste). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, Kawasaki I, Shim Y. (2010) J Cell Sci 123:993-1000.
ZT3 csr-1(fj54) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.