Caenorhabditis Genetics Center (CGC)

Rearrangement Information

NamenT1 View on WormBase
DescriptionRecommended use: General balancing, strain maintenance, mutant screens. reciprocal translocation:right arm of IV and left arm of V; N300 Handling: Easy to manipulate. Heterozygous males mate well. Vulvaless homozygous hermaphrodites completely unable to mate. Cause of vulvaless phenotype unknown. Translocation may break down spontaneously, but analysis of such events is lacking. Heterozygous strains occasionally begin to segregate large numbers of sick-looking progeny while appearing to remain heterozygous, or they occasionally begin to give larger broods (Schein and Baillie, unpublished results). nT1[qIs51] carries an integrated pharyngeal GFP element, and is homozygous inviable; this variant appears to be transferred to male cross progeny more frequently than to hermaphrodite cross progeny. Summary: Translocation, moderately well characterized, very stable. Very effective balancer for right portion of LG IV from right end through unc-17, and for left portion of LG V from left end through unc-76.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
BC2130 unc-22(s7) unc-31(e169) let-316(s1227)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and TwitcherUncLet. Lethal ??. Maintain by picking WT.
BC2137 let-312(s1234) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT.
BC2144 unc-22(s7) unc-31(e169) let-320(s1248)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and UncLet. Homozygous s1248 is a sterile adult. Maintain by picking WT.
BC2148 let-296(s1250) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vuls, early-mid larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed!
BC2628 sDf7/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, lethals (early larval) and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC2895 let-73(s685) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, Twitcher Steriles and dead eggs. Maintain by picking WT.
BC2897 let-72(s695) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, dead eggs, and UncLets. Lethal mid-larval. Maintain by picking WT.
BC2898 let-71(s692) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vuls and Lethal Twitchers (Late larval lethals). Maintain by picking WT.
BC2903 let-92(s504) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, dead eggs and UncLets. Lethal early larval. Maintain by picking WT.
BC2907 let-91(s678) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, mid-larval lethals that Twitch, Vuls and dead eggs.
BC3106 let-53(s43) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and throw WT, TwitcherLets, Vul and dead eggs. Lethal early larval. Maintain by picking WT.
BC3107 let-54(s44) unc-22(s7)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate more WT, Vul, and Lethal Twitchers. Lethal early larval. Heterozygotes twitch in 1% Nicotine.
BC3119 unc-5(e152) unc-22(s7) let-99(s1201) unc-31(e169) IV/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Egl, UncLet (maternal effect lethal) and dead eggs. Maintain by picking WT.
BC3199 sDf60 IV/nT1 (IV;V). C. elegans Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3247 unc-22(s7) unc-31(e169) let-323(s1719)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and UncLet. Homozygous s1719 are sterile adults. Maintain by picking WT.
BC3255 unc-22(s7) unc-31(e169) let-324(s1727)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, UncLets and dead eggs. UncLets die in early larval development. Maintain by picking Twitchers in 1% nicotine.
BC3261 let-653(s1733) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Early larval arrest (L1-L2). Maintain by picking WT. See also WBPaper00002328 and WBPaper00003721.
BC3266 unc-22(s7) unc-31(e169) let-325(s1738)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and dead eggs.
BC3276 let-655(s1748) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul, UncLet (Sterile) and dead eggs. Maintain by picking WT.
BC3282 unc-22(s7) unc-31(e169) let-319(s1754)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and UncLet. Lethal late larval. Maintain by picking WT.
BC3295 unc-22(s7) let-656(s1767) unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and TwitcherLetUnc. Maintain by picking WT.
BC3303 egl-38(s1775) unc-22(s7) unc-31(e169) IV/nT1 (IV;V). C. elegans s1775 homozygotes die as embryos or L1 larvae. Heterozygous animals are WT and segregate WT, Twitcher lethals and dead eggs. nT1 appears to have a lethal mutation.
BC3315 sDf61 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3316 sDf62 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3317 sDf63 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3318 sDf64 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3319 sDf65 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, lethal Uncs (arrest as L1) and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3320 sDf67 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3499 let-297(s1989) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed!
BC3840 sDf69(s2298) unc-22(s7) lev-1(x22)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC4006 sDf83 IV/nT1 [let-?(m435)] (IV;V). C. elegans sDf83 homozygotes arrest as late larva or sterile adults after 2 weeks.
BC4008 sDf85(s2089) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs. sDf85 homozygotes arrest as embryos or early L1 larva. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BS3347 lin-45(dx84) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc heterozygotes, non-Unc Steriles (lin-45 homozygotes), larval lethals, and dead eggs. dx84 is a strong lin-45 raf allele: dx84 homozygotes from dx84/+ heterozygotes are 47% larval lethal and among the adults, 100% are Sterile and Vul.
BS5182 sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.
BS5183 lin-45(oz201) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals, and dead eggs. oz201 is a strong lin-45 raf allele: oz201 homozygotes from oz201/+ heterozygotes segregate 55% larval lethal and the remaining adults are all Sterile and Vul.
BW163 ctDf1 V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs (heterozygotes) and dead eggs (ctDf1 homozygotes or nT1 homozygotes).
CA1117 dsb-1(we11) IV/nT1[unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs (dsb-1 homozygotes), which produce 99% inviable embryos due to meiotic nondisjunction. Pick Unc to maintain and check for correct segregation of progeny. we11 is a TCA to TAA nonsense mutation in the dsb-1 coding sequence that introduces a premature stop after leucine 96. Reference: Stamper EL, et al. PLoS Genet. 2013;9(8):e1003679.
CA649 ubc-9(tm2610) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs, and Pvul slow growing tm2610 homozygotes. Pick Unc to maintain and check for correct segregation of progeny. Reference: Bhalla N, et al. PLoS Genet. 2008 4(10) e1000235.
CB3616 tra-3(e1107) dpy-4(e1166)/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Dpy, Vul, and dead eggs. The Dpys throw Dpy males. Maintain by picking WT.
CB3988 tra-3(e1107) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Hets are Unc and segregate Unc, WT hermaphrodites and dead eggs. The WT hermaphrodites segregate only abnormal sterile males or intersexes. Maintain by picking Unc.
CB5166 dif-1(e2562) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, dead eggs, and WT (dif-1/dif-1). The WT animals give 100% dead eggs. dif-1 is a maternal effect embryonic lethal gene and e2562 is a putative null allele.
CB5378 unc-42(e270) let-560(e2658) V/nT1 (IV;V). C. elegans let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.
CB5535 hda-1(e1795) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, non-Unc Sterile Gon, and dead eggs.
CGC11 unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. C. elegans umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
CGC13 unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. C. elegans umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
CGC33 unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. C. elegans umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC39 unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. C. elegans umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC63 unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC71 unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. C. elegans umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CL6180 smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. C. elegans dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]