| VC2515 |
ruvb-2(ok3232) IV/nT1 [qIs51] (IV;V). |
C. elegans |
T22D1.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3232 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGAATTCACGGTTTTGTCG. External right primer: ATTTTCCAGGTTGAACGCAC. Internal left primer: GGGACAGAGCGTTTCCAAT. Internal right primer: CGCTAGACAAGCTGCAGGAC. Internal WT amplicon: 1244 bp. Deletion size: 457 bp. Deletion left flank: AACGAAAAGCATTCGATATCAAGCATATGA. Deletion right flank: CGCATTGTGAGTTTTCCGACCTTTGGTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2537 |
hil-2(ok2548) IV/nT1 [qIs51] (IV;V). |
C. elegans |
Y73B6BL.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2548 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACAAAGGTGGGAGGTACGC. External right primer: GAGCATGATGTGACACCCAC. Internal left primer: GGGGCAAAACTATGAGAGCA. Internal right primer: TTTTGCGCTTTTTCAGTGTG. Internal WT amplicon: 2810 bp. Deletion size: approximately 1700 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2539 |
noah-2(ok3197) IV/nT1 [qIs51] (IV;V). |
C. elegans |
F52B11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3197 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCTTAGGCACAGACGTAGG. External right primer: CACTGAGAGCGAGACGACTG. Internal left primer: GCACTGCTTCTTCCTGCTTC. Internal right primer: CAGAGAAGCTCGGTGGAGTC. Internal WT amplicon: 1129 bp. Deletion size: 806 bp. Deletion left flank: TGAATCCCAATTCGGAGGAATGGCTCTCTG. Deletion right flank: AGGAGAAGCTTTCGGCTATCATTCGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2540 |
C13F10.4(ok3257) V/nT1 [qIs51] (IV;V). |
C. elegans |
C13F10.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3257 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGACTCCTGATGACCGA. External right primer: CGTGGGCAGAGGTTTATGTT. Internal left primer: TCATCTGGCTGCTGACTGAC. Internal right primer: TGACTACAATGGAAGTGGTTCA. Internal WT amplicon: 1092 bp. Deletion size: 525 bp. Deletion left flank: TTTTCCACCTTCTTCGCCAGCGAACAATAC. Deletion right flank: GTTGAGAAATTGATCGGAGTAATGGGCAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2541 |
K02E11.10(ok3266) V/nT1 [qIs51] (IV;V). |
C. elegans |
K02E11.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3266 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCAACTTGTCCTTGTTGGG. External right primer: GGAGTGTGCAGCAAATTTCA. Internal left primer: CTTCGAAGCCTCCTTGAGTA. Internal right primer: GCGTCTTGAGGCCATAGTTC. Internal WT amplicon: 1208 bp. Deletion size: 582 bp. Deletion left flank: CCTGAGCAGGCCCTTGCTGATATCCGGCTC. Deletion right flank: GGCAGGCTAAGATCACAACGGATTTCATCT. Insertion Sequence: TTCCCTGAACTCCTTGAGCAGATCCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2542 |
vps-39(ok2442) V/nT1 [qIs51] (IV;V). |
C. elegans |
T08G5.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2442 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTGACATTGCACATTGGG. External right primer: CATACACGCCTTGCGAAGTA. Internal left primer: GGTAGTTTGAATCACCGCGT. Internal right primer: CTTGTTAGCCGGTGGAAGAG. Internal WT amplicon: 2794 bp. Deletion size: 1397 bp. Deletion left flank: CCACGACGGCTTTTCGATTTAAATTTCTAG. Deletion right flank: TTTCGAACAGAAAAGAATACCATTTCACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC255 |
+/nT1 IV; him-17(ok424)/nT1 V. |
C. elegans |
T09E8.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok424 hermaphrodites (Him with small broods and lots of inviable embryos). The ok424 homozygotes can be maintained. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2554 |
lin-66(ok3326) IV/nT1 [qIs51] (IV;V). |
C. elegans |
B0513.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3326 homozygotes (late larval arrest or sterile adult, tends to explode). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAAGTCCTTCCACCGTCTA. External right primer: TTGATCAAGCACGACAAAGC. Internal left primer: AACAGAGAGCCGACACCATC. Internal right primer: TCTACGGCATTGCAGTGTTC. Internal WT amplicon: 1385 bp. Deletion size: 707 bp. Deletion left flank: TATGATCTCTATGATCTACCAAGGTTAGCC. Deletion right flank: AGTCGCTGTTCGACTACTACGGTAGCCCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2572 |
JC8.2(ok3322) IV/nT1 [qIs51] (IV;V). |
C. elegans |
JC8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3322 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGGCAAAATTGGATTTCTC. External right primer: ATTCTCGATGCTCCACCATT. Internal left primer: AATAATTCCGCAACGAAACG. Internal right primer: CAACATGATCCAGGAAACGA. Internal WT amplicon: 1109 bp. Deletion size: 478 bp. Deletion left flank: AAACTGCCGAGACCATAGGTAATGTAATTT. Deletion right flank: CTTCCATCATCAGACGAGCAGAACGCGGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2579 |
C10B5.1(ok3270) V/nT1 [qIs51] (IV;V). |
C. elegans |
C10B5.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3270 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCATCCCGATGATCTCATTT. External right primer: GCGTCAAATATGGTGAGCAA. Internal left primer: CATTTCATGGTTTTGCTCCA. Internal right primer: TTCTCAGAATTTAGTGTTTCCGT. Internal WT amplicon: 1224 bp. Deletion size: 573 bp. Deletion left flank: TCGTAGTGTGACGTCATTCTACAGTTTAGA. Deletion right flank: CAACAAAATCGAATCGAATTCTGGATGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2582 |
B0035.11(gk1081) IV/nT1 [qIs51] (IV;V). |
C. elegans |
B0035.11. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: TTCGGACATAGTGGTTCCGT. External right primer: TTACGTTCCCCAGTGTCTCC. Internal left primer: AGCGAGGAAGACGTAGTGGA. Internal right primer: TGCACCAGGAACACCAGTTA. Internal WT amplicon: 1795 bp. Deletion size: 710 bp. Deletion left flank: GGAAGGTCATACGATGTGTAAGAACAGCTT. Deletion right flank: CTTTCGGCTTTCCTTCTCTGTCGGAATCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2638 |
rps-18(ok3353) IV/nT1 [qIs51] (IV;V). |
C. elegans |
Y57G11C.16. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3353 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCTTTCGTCTCTCTTCGGA. External right primer: GGCAACACTCATGCTTCTCA. Internal left primer: TGGCTTTTTCCGTTGAAACT. Internal right primer: CTTGGACAGGAAGGTGTTGG. Internal WT amplicon: 1340 bp. Deletion size: 442 bp. Deletion left flank: GCATCTCACTAAATTTTTTATTTTTCAGGG. Deletion right flank: GCCACCCAGTTTAATTATTTTGAGAGTAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2642 |
lam-1(ok3221) IV/nT1 [qIs51] (IV;V). |
C. elegans |
W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3221 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 303 bp. Deletion left flank: ATCCCGTTGGATGGGAGAATATTCAAATTA. Deletion right flank: ATCGTTATCAATGTAGACATCTTGCTCTTT. Insertion Sequence: TTGTAGTGAGACCGGAAGCTGAAGGAGATGGATCATGCTCTGATGCTCCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2644 |
skp-1(gk1091) V/nT1 [qIs51] (IV;V). |
C. elegans |
T27F2.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1091 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATAGAGACCCGGATGCAAA. External right primer: AACAGGTCCAGATCCACGAC. Internal left primer: CTCACAAACCGCCATGATTA. Internal right primer: TGAACCAGAACGGACATGAA. Internal WT amplicon: 2496 bp. Deletion size: 1422 bp. Deletion left flank: ACAAGTTAGCACCTGCTCAATATATCAGAT. Deletion right flank: ACAAAACTCTTTGATGATACTGATGTATTT. Insertion Sequence: GGAGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2645 |
F32D1.2(ok3436) V/nT1 [qIs51] (IV;V). |
C. elegans |
F32D1.2. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGAATCCGAAGGTGTCTC. External right primer: GCAGCCCAGTCTGTGTTGTA. Internal left primer: GATCATCGTTATTTTCGCCG. Internal right primer: TATAGAGCCGGGCTGAAATG. Internal WT amplicon: 1263 bp. Deletion size: 791 bp. Deletion left flank: AATGTATCCAAATGGAATTATTCGAATACT. Deletion right flank: CTGGTGGGTCTCGCAACGACATGAAGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2662 |
F57F5.1(ok3370) V/nT1 [qIs51] (IV:V). |
C. elegans |
F57F5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3370 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCTAGTAGCGAAATG. External right primer: CAATTTTGGAATTCCTCCGA. Internal left primer: CTCTTCTTGTCGGCCTTGTC. Internal right primer: CCTCAATTCCGCACTCGTTA. Internal WT amplicon: 1101 bp. Deletion size: 337 bp. Deletion left flank: TTACAAGCCATGCCCATCCAACATGTACCC. Deletion right flank: GTTAACGAGTGCGGAATTGAGGGAGGAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2663 |
lsm-5(ok3431) V/nT1 [qIs51] (IV;V). |
C. elegans |
F28F8.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3431 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAATTCCCTCTCACAA. External right primer: TTTCCAGGGACGATCTGAAC. Internal left primer: CTGTTGGGTCTCGGAACTGT. Internal right primer: CAACACGTGCTGAATATGATCC. Internal WT amplicon: 1270 bp. Deletion size: 509 bp. Deletion left flank: TGTACAACGACACTCCGAAATGACGCATAG. Deletion right flank: CATCGGCTCGAAAATCTGGGTGATAATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2670 |
sos-1(ok3565) V/nT1 [qIs51] (IV;V). |
C. elegans |
T28F12.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3565 homozygotes (arrest stage/phenotype undetermined). Any viable non-GFP progeny are not homozygous mutants but rare recombinant heterozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGCAGTCAGGGAAG. External right primer: AAAAGCGTGCTCGACAGAAT. Internal left primer: TCGCGATTTGAAAAGTTGTG. Internal right primer: GACAATCACGAAAAGGAAGAGG. Internal WT amplicon: 1126 bp. Deletion size: 884 bp. Deletion left flank: TCTCATCATGATGTCTCGGTATTTTTTTGT. Deletion right flank: CGTATAAGAATGATATGTCAGTCGTTCAAT. Insertion Sequence: ACAAAACAAAATATGCTTGACTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2682 |
rpl-18(ok2217) IV/nT1 [qIs51] (IV;V). |
C. elegans |
Y45F10D.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2217 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTACAGCGAACTCGGGA. External right primer: TTCCACGTATACGCCAACAA. Internal left primer: GTTGTCCGTGGAGAAGGGTA. Internal right primer: TTTTATGCAGATGGCAACCA. Internal WT amplicon: 2215 bp. Deletion size: 1161 bp. Deletion left flank: TTCTACTAGCCTAAAATTTTTTTCACGTTT. Deletion right flank: GAAGGAAGGAACAATAACGATACACTTATC. Insertion Sequence: CATATATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2699 |
rpn-1(ok2205) IV/nT1 [qIs51] (IV;V). |
C. elegans |
T22D1.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2205 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTGTGTCCGGTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2744 |
acs-1(gk3066) V/nT1 [qIs51] (IV;V). |
C. elegans |
F46E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3066 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCGATCAGCAGTTGACCA. External right primer: CAAAGTTGGCAATGGTTGTG. Internal left primer: CAACACAGTTTGCCAGTGCT. Internal right primer: GAGACGACTTGCTGGAGACC. Internal WT amplicon: 2067 bp. Deletion size: 880 bp. Deletion left flank: TTTATTTTAAAAAATATTTAAAAAGTTTTA. Deletion right flank: TATGACTGACATGCAAGTATGCTATGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC276 |
+/nT1 IV; aip-1(ok537)/nT1 V. |
C. elegans |
F58E10.4. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok537 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2762 |
F28D1.1(ok3338) IV/nT1 [qIs51] (IV:V). |
C. elegans |
F28D1.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3338 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCAGCTTGAACGACATGA. External right primer: AACATACTCGTGAATCCGCC. Internal left primer: GAGGAGGATCACTCGCTGAC. Internal right primer: GTCCAATTCCGAGCACATCT. Internal WT amplicon: 1167 bp. Deletion size: 433 bp. Deletion left flank: ACAGCTCGCCTCGAATTTCTTCCCCATCAT. Deletion right flank: CGTGTAAAGAGCCGTATTTGGTGCACAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2791 |
egl-38(ok3510) IV/nT1 [qIs51] (IV;V). |
C. elegans |
C04G2.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3510 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCCCTACCCTACCCTCTG. External right primer: CGACTCCACAGTGCTTTCAG. Internal left primer: GCCCGGTTTTACCCTGTATT. Internal right primer: TTCCGCCTCAAAAGTTTCTC. Internal WT amplicon: 1203 bp. Deletion size: 786 bp. Deletion left flank: AAAATTTTACAAATTAAGCGAATAATACTT. Deletion right flank: GCGATTACAAAATTAATTTGTATTCCTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2792 |
sar-1(ok3513) IV/nT1 [qIs51] (IV:V). |
C. elegans |
ZK180.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3513 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTATGCACAAACGTCGAAGG. External right primer: TTCTCACCCCCATTTAACCA. Internal left primer: ATCCCAAGGATCCCAAAAGA. Internal right primer: AAAATGCCTGATTTACCCGA. Internal WT amplicon: 1167 bp. Deletion size: 425 bp. Deletion left flank: ATTCCTTCTCCGTATCCTTGTCGCTGAAGA. Deletion right flank: TCGTATGTGGTAAACGAAATTCCTCCGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2839 |
T05H4.11&atp-4(ok2678) V/nT1 [qIs51] (IV;V). |
C. elegans |
T05H4.11. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2678 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTTTGAAGCTCGACGTG. External right primer: CGTAATGGCCTCATTCGTTT. Internal left primer: ATTCGAATGGAACCGAGTCA. Internal right primer: TTTCCCGTTTGTAACCTCCA. Internal WT amplicon: 2683 bp. Deletion size: 1414 bp. Deletion left flank: TTGTGTTTCAAATCGGACACTCTGCAAAAT. Deletion right flank: CCTTAGCAGCTTCAAAGTTAGTTGGGAGCT. Insertion Sequence: TCGTTTATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2840 |
C24D10.4(ok3613) IV/nT1 [qIs51] (IV;V). |
C. elegans |
C24D10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3613 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGATGAGAACATCATCCT. External right primer: TCCTATTACATCGCCGTTCC. Internal left primer: AAATCAGAAAATCCGAAGAAAA. Internal right primer: CGACTTCCAGAGGATTGTCC. Internal WT amplicon: 1195 bp. Deletion size: 418 bp. Deletion left flank: TTGTCAATGGAGCGCGCTTACGCAGCTAAA. Deletion right flank: AGTTCCCCGGATTTCCCAGCGAATTTCCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2854 |
H43I07.2(ok3654) V/nT1 [qIs51] (IV;V). |
C. elegans |
H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2878 |
F29B9.2(ok3628) IV/nT1 [qIs51] (IV;V). |
C. elegans |
F29B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3628 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGCTTATCAAGCACACGA. External right primer: AACCGCGTGAAAGAATATGG. Internal left primer: CATCTCCGGACACCACTACA. Internal right primer: GCTTCTTCATGAGGCGATCT. Internal WT amplicon: 1193 bp. Deletion size: 823 bp. Deletion left flank: ATCAAGGAAGGTCAGACACTGCTCATCCCG. Deletion right flank: ACTATTGTGGATCCCATCTCGAAGCACGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2879 |
glb-3(ok3630) V/nT1 [qIs51] (IV;V). |
C. elegans |
C06H2.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3630 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGTGAACAAATGGGCAA. External right primer: AATGCGATTGAGATGAAGCA. Internal left primer: TCGAAGAATGAGTCGAGCAA. Internal right primer: TGGACCTGAAAACCAAATGA. Internal WT amplicon: 1341 bp. Deletion size: 975 bp. Deletion left flank: ATTCCTAAAAACGAATTAACCCAAAGTTTG. Deletion right flank: AATGACAGTCTAGGTGTATCTAGAAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2901 |
F52C12.2&F52C12.6(gk3019) IV/nT1 [qIs51] (IV;V). |
C. elegans |
F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC292 |
+/nT1 IV; sun-1(gk199)/nT1 V. |
C. elegans |
F57B1.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk199 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2998 |
T09E8.1(ok3692) V/nT1 [qIs51] (IV;V). |
C. elegans |
T09E8.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3692 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATGGACCGGTCACTAAT. External right primer: GGGGTAGGCAAACATTCTGA. Internal left primer: CGATGCTCGGATTGCTTATC. Internal right primer: CCTCAAGTTGTTCTCAGGTTCA. Internal WT amplicon: 1186 bp. Deletion size: 657 bp. Deletion left flank: AACTTGAACTGACACAAAAAGAACAGAGCT. Deletion right flank: GAATTTGAGAGAATGCGATCAGAGAAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3010 |
uaf-2(gk3159) IV/nT1 [qIs51] (IV;V). |
C. elegans |
Homozygous lethal deletion chromosome (gk3159 in Y116A8C.35) balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3159 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCTGAGCAGTTTGCAGGTG. External right primer: TTTCTGTAAAAATTGGCCGC. Internal left primer: CTCCATATCCGTAGCCTCCA. Internal right primer: GATGCAAGAGACGCAGAGAA. Internal WT amplicon: 2193 bp. Deletion size: 871 bp. Deletion left flank: CCGCCTCCGGAACCTCCACGTTGTGATGGA. Deletion right flank: AGTGGCACGTTCTCTTCACAGCACTTGAGC. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC302 |
rib-1(ok556)/nT1 IV; +/nT1 V. |
C. elegans |
F12F6.3. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok556 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC303 |
+/nT1 IV; stdh-4(ok543)/nT1 V. |
C. elegans |
F25G6.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok543 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3054 |
F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V). |
C. elegans |
F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3062 |
F25H8.2(ok3636) IV/nT1 [qIs51] (IV;V). |
C. elegans |
F25H8.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3636 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGCAAACATGCTCCAATGA. External right primer: ATTATCCGATCTGGCAGGTG. Internal left primer: AACAAACGACACTCCGATTTC. Internal right primer: ATCTCGTTTTCGCCCTCTGT. Internal WT amplicon: 1333 bp. Deletion size: 333 bp. Deletion left flank: GAATGATTAGATTTCTAGCGTAATGTTCAC. Deletion right flank: AGAAGTTTTATAGGCATCGATGATACCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3070 |
rab-1(ok3750) V/nT1 [qIs51] (IV;V). |
C. elegans |
C39F7.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3750 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTACGACGTGAATTTGGGG. External right primer: TTCTTGCACTGTTCGTCTGG. Internal left primer: AGGGGAGAGAAAAGACAGCA. Internal right primer: CTCCTGTTGCTGACCGATTT. Internal WT amplicon: 1245 bp. Deletion size: 538 bp. Deletion left flank: ATAATCCTGGGCAGCTTGAGTCTCCACAGC. Deletion right flank: AAATTGGGAAAAAAATTGTTAGAAACCGAA. Insertion Sequence: AGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3084 |
C34B4.1(ok3727) V/nT1 [qIs51] (IV;V). |
C. elegans |
C34B4.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3727 homozygotes (Unc, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGCAGCCGAAAGTATCGT. External right primer: TGGACTGACTTCAGACGACG. Internal left primer: AAGGCATAAGCTGCTCCTTG. Internal right primer: GCCTGAAAACAAAGCAGGAA. Internal WT amplicon: 1143 bp. Deletion size: 711 bp. Deletion left flank: GTGACAGATCGAATATCTGATATACTGATT. Deletion right flank: CTTCAATGTCATACTCGTAATCTTCCGCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC309 |
tag-65(ok535) V/nT1 (IV;V). |
C. elegans |
F58G11.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok535 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC313 |
+/nT1 IV; ttn-1(gk171)/nT1 V. |
C. elegans |
W06H8.8. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk171 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3138 |
ric-8(ok98) IV/nT1 [qIs51] (IV;V). |
C. elegans |
Y69A2AR.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok98 homozygotes (paralyzed, sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGTCTTTACATCCGTCATTTCTG. External right primer: CATGATCAATAGCCTTCACATCTC. Internal left primer: AAGCGTCCAAGGCACATATCG. Internal right primer: CGTCTTCAACGCCTCGGTAG. Internal WT amplicon: 3370 bp. Deletion size: approximately 1480 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC317 |
hgrs-1(ok579)/nT1 IV; +/nT1 V. |
C. elegans |
C07G1.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok579 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3177 |
R04B5.5(gk3064) V/nT1 [qIs51] (IV;V). |
C. elegans |
R04B5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3064 homozygotes (mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 894 bp. Deletion left flank: AATGGGACACCGAGTTCTTGTTCTCGGAGC. Deletion right flank: TATTAAAATGCCGAGAGGAAACATGATGTC. Insertion Sequence: AGGACCAATTGGAGTCTTGAATCTTCTTACTGCTAAAGCGATAGGTGCATCAAAAGTAG TAATCACTGATTTGAACGACGAGAGACTTGCTCTTGCACGCCTATTAGNAGCTGATGCT ACAATCAATGTTATGTAATAAAGAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3189 |
ceh-32(ok343) V/nT1 [qIs51] (IV;V). |
C. elegans |
W05E10.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok343 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTACCGGATTTGAGACGAA. External right primer: TCAAGCACTTCAAGCCAATG. Internal left primer: AATTGGAAAACGTTCCATGC. Internal right primer: CGTTAGCTGCTCCATCATCA. Internal WT amplicon: 3023 bp. Deletion size: 2073 bp. Deletion left flank: ATTGTGTTGAAAAAGTTGTGGAATTGCATG. Deletion right flank: ATGGCTCATACTTTTCATCATAAAACATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC321 |
nhr-105(ok473)/nT1 IV; +/nT1 V. |
C. elegans |
C06G3.1. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok473 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3210 |
R11A8.2(gk3090) IV/nT1 [qIs51] (IV;V). |
C. elegans |
R11A8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3090 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGTATTATGGCAGCTCAC. External right primer: CGTTCGAGCCCACATTTTAT. Internal left primer: CGATTTTGATTTTTACAATTGCTG. Internal right primer: ATCATTTTGAAAGGGAGACTCAAC. Internal WT amplicon: 1355 bp. Deletion size: 373 bp. Deletion left flank: AGTTTCGATTAAATTTTTTTAAATTTAAAT. Deletion right flank: CTTCCGAATCGACGACCGCCTGGACTCGGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC322 |
+/nT1 IV; cpl-1(ok360)/nT1 V. |
C. elegans |
T03E6.7. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok360 hermaphrodites (arrest stage/phenotype undetermined, but possibly sterile). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3269 |
gcy-13(gk3118) V/nT1 [qIs51] (IV;V). |
C. elegans |
F23H12.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3118 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCCTTTCCTGCACCTCAT. External right primer: CGCCGTACAATTGTGTTGAC. Internal left primer: CTTACCCAGACCTGCCAGAA. Internal right primer: TTGAAGGAATGTCGGGAGTT. Internal WT amplicon: 1579 bp. Deletion size: 310 bp. Deletion left flank: GATACTTCCACGACTACAATATCTCCAAAA. Deletion right flank: ACAATCCATTGATCATCTAATCTTAACTCT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
