Caenorhabditis Genetics Center (CGC)

Rearrangement Information

NamenT1 View on WormBase
DescriptionRecommended use: General balancing, strain maintenance, mutant screens. reciprocal translocation:right arm of IV and left arm of V; N300 Handling: Easy to manipulate. Heterozygous males mate well. Vulvaless homozygous hermaphrodites completely unable to mate. Cause of vulvaless phenotype unknown. Translocation may break down spontaneously, but analysis of such events is lacking. Heterozygous strains occasionally begin to segregate large numbers of sick-looking progeny while appearing to remain heterozygous, or they occasionally begin to give larger broods (Schein and Baillie, unpublished results). nT1[qIs51] carries an integrated pharyngeal GFP element, and is homozygous inviable; this variant appears to be transferred to male cross progeny more frequently than to hermaphrodite cross progeny. Summary: Translocation, moderately well characterized, very stable. Very effective balancer for right portion of LG IV from right end through unc-17, and for left portion of LG V from left end through unc-76.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
MT15537 unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. C. elegans Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
MT17143 nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. C. elegans Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.
MT1821 lin-25(e1446) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Hets are Unc and segregate Unc, Vul and dead eggs. Maintain by picking Uncs.
MT18690 sfa-1(n5223) IV/nT1 [qIs51] (IV;V). C. elegans Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
MT2115 nDf27/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT.
MT4628 nDf27 IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs.
MT4629 mars-1(s254) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Lethal Twitchers and dead eggs. Lethal mid-larval; some twitchers make it to almost adults but are always sterile. Maintain by picking WT.
MT5499 let-60(n1876) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Lethal twitchers and dead eggs.
MT5734 nDf41 IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Unc. nDf41 is homozygous lethal. Throws dead eggs.
MT5748 let-60(n2022) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans
MT5749 let-60(n2034) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, Vul and dead eggs.
MT5750 let-60(n2035) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans
MT5813 nDf42 V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs and dead eggs.
MT8256 lin-1(n304) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, Muvs and dead eggs.
MT8384 lin-1(sy254) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, Muv and dead eggs.
MT8998 unc-24(e138) sqv-1(n2819) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile.
MT8999 unc-42(e270) sqv-4(n2827) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Hets are Unc (n754) and segregate Unc (n754), Unc(e270)Sqv and dead eggs. n2827: mid-L4 vulva abnormal, sterile.
MT9352 sqv-6(n2845) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, Steriles and dead eggs. n2845: mid-L4 vulva abnormal, sterile.
MU1255 nhr-67(tm2217) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2217 homozygotes (arrested L1 larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
MU1269 nhr-67(pf88) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. Pick GFP+ to maintain -- viable pf88 homozygotes (Pvl Egl) can overtake the balanced population. nT1[qIs51] is homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Reference: Verghese E, et al. Dev Biol. 2011 Aug 15;356(2):516-28.
NB327 ints-6(tm1615) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploids, and non-GFP dic-1 homozygotes. dic-1(tm1615) homozygotes arrest at the L3 larval stage. ints-6 previously known as dic-1.
NF963 fbl-1(tk45) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. fbl-1(tk45) homozygotes are Dpy, Sterile and are Distal Tip migration defective.
NW1675 mig-6(oz113) V/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are wild-type and GFP+. Heterozygotes segregate WT GFP+, sterile GFP- homozygotes, and dead eggs. Maintain by picking GFP+ wild-type.
OCF12 lpin-1(ok2761) V/nT1 [qIs51] (IV;V). C. elegans Heterzygotes are wildtype and GFP+. lpin-1(ok2761) homozygotes die as L1 larvae. Homozygous nT1[qIs51] inviable.
PD8292 ceh-22(cc8266) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, non-Uncs and dead eggs.
PS4627 let-60(n1046) unc-31(e169) V/nT1 [let(m435)] (IV;V). C. elegans Maintain by picking WT. Segregates Muv Unc (let-60 unc-31 homozygotes), wild-type heterozygotes and dead eggs. Reference: Moghal N, Sternberg PW. Development. 2003 Jan;130(1):57-69.
PS524 let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS536 unc-24(e138) let-60(sy99) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are Vul (97% Egl). Segregates dead eggs. sy99 homozygotes are lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS538 unc-24(e138) let-60(sy92) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are Vul and segregate Vul, Unc-24 lethals and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RA520 swsn-4(tm305) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are mostly wild-type GFP+, but occasionally have missing gonad arms. Pick wild-type GFP+ to maintain. Heterozygotes segregate wild-type GFP+, GFP- tm305 homozygotes (embryonic lethal) and arrested nT1 aneuploids. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RB1143 F36D4.2(ok1128) V/nT1 [qIs51] (IV;V). C. elegans F36D4.2 Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1128 homozygotes. nT1[qIs51] homozygotes inviable. Outer Left Sequence: agtcatgaacagatccccca. Outer Right Sequence: attgcttggacgagaggaga. Inner Left Sequence: tgcttttattcgcacccagt. Inner Right Sequence: tggatctgcaagtccatctg. Inner Primer PCR Length: 2151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1217 F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). C. elegans F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1221 his-74(ok1219) V/nT1 [qIs51] (IV;V). C. elegans W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1223 sph-1(ok1199) IV/nT1 [qIs51] (IV;V). C. elegans F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1225 pxf-1(ok1186) IV/nT1 [qIs51] (IV;V). C. elegans T14G10.2a Heterozygotes are WT and GFP+. Outer Left Sequence: ttgaaatttcgaagatcccg. Outer Right Sequence: catgcccgattatctccact. Inner Left Sequence: acccaccacatttcacgatt. Inner Right Sequence: ttcgattgaccctcatctcc. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1228 arx-2(ok1269) V/nT1 [qIs51] (IV;V). C. elegans K07C5.1 Heterozygotes are WT and GFP+. Outer Left Sequence: tccaatttggcttcaacaca. Outer Right Sequence: catcgacttccgcgtatttt. Inner Left Sequence: tttgaatgagagtgggggag. Inner Right Sequence: ttttcaggcgaaatggattc. Inner Primer PCR Length: 2734. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1235 T28C6.1(ok1264) IV/nT1 [qIs51] (IV;V). C. elegans T28C6.1 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms as the balancer may break down. ok1264 animals are homozygous viable. Outer Left Sequence: TCCCTGTTCCATTTTTGAGC. Outer Right Sequence: CATCACCTCTACCACCCCAT. Inner Left Sequence: AAGCCAAGAATTCGCAAAAA. Inner Right Sequence: CAACACCACCATGACCTGAA. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1246 nxf-1(ok1281) V/nT1 [qIs51] (IV;V). C. elegans C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1276 sun-1(ok1282) V/nT1 [qIs51] (IV;V). C. elegans F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1277 gcy-6(ok1293) V/nT1 [qIs51] (IV;V). C. elegans B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1280 F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). C. elegans F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3034 +/nT1[umnIs49] IV; C37C3.7(ve534[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, Mig. Deletion of 1217 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Mig GFP+ non-mKate2 (ve534 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAAGTCGATGCCGTTCTGCAGTATCCTTCA ; Right flanking sequence: TACAATGACAAATCCCTCCAGCATAGATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3039 spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. C. elegans F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3040 +/nT1 [umnIs49] IV; F58H1.6(ve540[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste with a few escapers. Deletion of 1527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve540 homozygotes, some escapers will lay broods), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aagtccgagataaataatctacatcctcat ; Right flanking sequence: TATCCAAGAAACACAGATTGGGATTGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3046 C46G7.1(ve546[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 1523 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, larval lethal GFP+ non-mKate2 (ve546 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatacaatttacaggtaaaagccggcaac ; Right flanking sequence: ATCGGAATTGCAGTTCTTCTTTCACTTCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3062 C05C8.7(ve562[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 3553 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (ve562 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: attgaaaaaagtgttggtattaccccgtaa ; Right flanking sequence: TATGGTGTCTTCTGATCAATTTGGAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3065 +/nT1 [umnIs49] IV; nol-56(ve565[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs.  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tgcgcaaaactgtacCTTCTCCTTAACCTC ; Right flanking sequence: Tggtgtaagaacctgaaaaatcatttattc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3074 +/nT1 [umnIs49] IV; mcm-3(ve574[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste. Deletion of 2846 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate adults (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tagtacaataggcaatgtaaaatcaatgtg ; Right flanking sequence: cggggaaaatagaaaaattcggcccaaatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3089 dgtr-1(ve589[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve589 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaactacggtcaaaatcgttgcgagaccct ; Right flanking sequence: GACACTCATCTCATCTTCCAGTGActtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3091 +/nT1 [umnIs49] IV; dlst-1(ve591[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. C. elegans umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae (ve591 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattaaaaattttgtgaaagcatgaccaa ; Right flanking sequence: TCTGGAAAGAAACCGATGAACTGATACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.