Rearrangement Information

NamemnC1 View on WormBase
DescriptionGrowth characteristics: Homozygotes viable with extremely small broods (average: 7 progeny). Brood size in heterozygotes ~200, with 100% egg hatching. Recommended use: General balancing, strain construction, strain maintenance, mutant screens. Handling: Easy to manipulate. Heterozygous male stocks mate well. Very rare recombination gives rise to Dpy non-Unc and Unc non-Dpy progeny. The recombinant chromosomes carried by these progeny are homozygous lethal. Balancer Summary: Dominant crossover suppressor, uncharacterized with regard to structure, very stable. Very effective balancer for right portion of LG II from around dpy-10 to around unc-52.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
KS100 egl-27(ok151)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Egl and DpyUnc. Temperature sensitive Egl. Do not grow at 15C.
LB10 nuo-1(ua1)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.
MG8 csc-1(t1171) dpy-2(e8)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-3(e1147) IV. C. elegans Heterozygotes are WT and segregate WT, DpyUncs, and Dpys which give only dead eggs. Throws males.
ML335 dpy-2(e489) mcDf1 unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. mcDf1 homozygotes arrest as dead eggs.
ML581 lin-26(mc15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate dead eggs, DpyUncs and WT. lin-26(mc15) is a molecular null due to a deletion of most of lin-26 coding sequence.
ML610 lir-1(mc33) mcDf3/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. mcDf3 is a deficiency very closely linked to lir-1 - not separable - which removes approx. 250 kb.
ML93 dpy-2(e489) lin-26(mc1) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and dead eggs (mc1 homozygotes). mc1 is a strong loss of function mutation, but probably not null. mc1 is an embryonic lethal mutation with degeneration of hypodermal cells.
MT11826 sqv-7(n3789)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs, and Sqv which are sterile (probably Mel). The bases 17746 to 19294 of the C52E12 cosmid sequence are deleted and 19295 to 19316 are duplicated. The N terminal 239 bases of coding sequence for sqv-7 are left intact; they are predicted to encode 79 amino acids (of 329 amino acids total) of SQV-7 (followed by a frameshift).
MT13664 nurf-1(n4293)/mnC1 [dpy-10(e128) unc-52(e444)] II; lin-15B&lin-15A(n765) X. C. elegans n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.
MT20110 unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. C. elegans nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
MT20111 unc-4(e120) bli-1(e769)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. C. elegans nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
MT3316 lin-4(e912)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans
MT4156 lin-26(n156)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. C. elegans Heterozygotes are WT and segregate WT, Egls with abnormal tails and DpyUncs.
MT5823 lin-26(n156) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. C. elegans Heterozygotes are WT.
MT7480 sqv-8(n2825)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are somewhat sterile.
MT7483 sqv-8(n2822)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are sterile.
MT8191 snt-1(md290) unc-104(e1265) II/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Unc, and paralyzed Dpy Uncs. Reference: Jorgensen EM, Nature. 1995 Nov 9;378(6553):196-9.
MT9088 sqv-7(n2844) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, UncSqv and DpyUncs. n2844: mid-L4 vulva abnormal, sterile.
MT9940 dpl-1(n3316) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. n3316 is Mel. 1422 bp deletion removes cosmid T23G7 nt 5200-6621.
NG2295 hlh-14(gm34)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs, and arrested larvae (hlh-14 homozygotes).
NJ549 dpy-10(e128) unc-104(rh142)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Severe unc-104 allele, hypercontracted coiler. Dpy heterozygotes segregate Dpy, mnC1 dpy-10 unc-52 homozygotes (paralyzed Dpy), and very small and sick dpy-10 unc-104 homozygotes.
NL344 gpb-1(pk44)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans
OK245 pyr-1(cu8) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype.
OT125 mua-9(rh197)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes.
PD7217 let-852(cc504) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7218 let-853(cc505) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7220 let-854(cc507) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys and dead eggs. cc507 is a recessive embryonic lethal.
PD7222 let-855(cc509) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7227 let-856(cc514) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7229 let-857(cc516) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys and embyronic lethals.
PD7244 let-856(cc529) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD8662 lin-31(n301) hlh-1(cc450)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975.
PJ801 jDf1/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed.
PJ803 jDf2/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are Unc (Paralyzed adult) and segregate more Unc, DpyUnc and dead eggs. Pick Unc to maintain. Balanced well.
PK172 ptc-1(ok122) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, paralyzed Dpys, and Uncs which are sterile (with 1-2 escaper progeny). ptc-1 homozygotes have multinucleate germ cells (both sperm and oocytes). ptc-1 homozygotes have an underproliferated germline.
PS1410 let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1423 let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1524 let-23(sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans 10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS295 let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS302 let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3411 cog-1(sy607)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Pvul Sterile cog-1 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4064 let-23(sy621sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RG3066 snpc-1.1(ve566[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ animals. Left flanking Sequence: agattaataaaataacaaaagtcggagatg ; Right flanking sequence: gcgggaaccagcggtattcaacgcatttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3090 dhps-1(ve590[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 4636 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttttcagaaacttgctccaaaATGAGCAC ; Right flanking sequence: agGAGTCGTAAAACACCACATCAACAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3106 rpa-1(ve606[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve606 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttctacgccattttttttggcgcgtatccg ; Right flanking sequence: atccacaatcgctgattttgtacaatgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3142 gtf-2E2(ve642[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 1631 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve642 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaaaataacttgaaacttcaaaagaaata ; Right flanking sequence: TTCGCTTTTGCTGCTTCTGAAGAGTATGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3147 T14B4.3(ve647[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve647 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaccaatgctgatgaaatcaacttccacgg ; Right flanking sequence: GATGGGTAGACAGAAGAAAGATTAGaatta. sgRNA #1: caagagaacttgaaactccg; sgRNA #2: GATCCTGGTTCGACTATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3154 T26C5.5(ve654[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygotes are unhealthy, lay small broods. Deletion of 696 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 unhealthy animals (ve654 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcactacattgcctcCTAACATGTCCTTCC ; Right flanking sequence: gggggtttcctctttctttctttttaaaga. sgRNA #1: ATACATATTATTGGATTGGA; sgRNA #2: attgaaatggagaaggacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3155 vps-2(ve655[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve655 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CTCTTCTAAGCTGATCAAGACGGGCCTGAA ; Right flanking sequence: AGGAAATCCATctgaaaagtggaatatttc. sgRNA #1: TGATGTTGACGATGATCTTC; sgRNA #2: tttcagATGGATTTCCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3177 T21B10.3(ve677[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 4525 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adult animals that lay dead eggs (ve677 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gctcgtaacagcaaaATGAATAATCCAGAA ; Right flanking sequence: attgaattcgtatttttttccattccacat. sgRNA #1: TCTGTTACAGCGCTTTCTTC; sgRNA #2: aaaaatacgaattcaatggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.