Rearrangement Information

NamemnC1 View on WormBase
DescriptionGrowth characteristics: Homozygotes viable with extremely small broods (average: 7 progeny). Brood size in heterozygotes ~200, with 100% egg hatching. Recommended use: General balancing, strain construction, strain maintenance, mutant screens. Handling: Easy to manipulate. Heterozygous male stocks mate well. Very rare recombination gives rise to Dpy non-Unc and Unc non-Dpy progeny. The recombinant chromosomes carried by these progeny are homozygous lethal. Balancer Summary: Dominant crossover suppressor, uncharacterized with regard to structure, very stable. Very effective balancer for right portion of LG II from around dpy-10 to around unc-52.
Genetic positiongenetic position unknown or not listed
Genomic positiongenomic coordinates unknown or not listed

Strains carrying this rearrangement

Strain Genotype Species Description
RG3217 Y48B6A.1(ve717[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. C. elegans umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 3274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve717 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ataataacaaaagaaaacgaaggtgtaaca ; Right flanking sequence: cccaacatttttccgatttcaatttctctt. sgRNA #1: aataaaaacaaagaacaacg; sgRNA #2: cctaaaatcgcgacgcacta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG93 lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle).
SA29 kel-1(pe201)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and L2 larva. kel-1(pe201) homozygotes arrest development at early L2. pe201 deletes a 3.6 kb region including most of the kel-1 ORFs.
SA4 cdl-1(w37)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, dead eggs (homozygous cdl-1(w37)), and DpyUnc. w37 carries a 4.7kb deletion that removed the entire cdl-1 ORF and part of the neighboring ORF (T19E10.1), with a small insetion of about 60 bp.
SP127 unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, Unc-4 and paralysed DpyUnc (mnC1). Maintain by picking WT.
SP140 him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-28(mn28) II. C. elegans Hets are WT and segregate WT, dead eggs, paralyzed DpyUnc and males. Maintain by picking WT.
SP142 him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-30(mn30) unc-4(e120) II. C. elegans Maintain strain by picking WT hermaphrodites. Segregates WT, dead eggs, paralysed DpyUnc and males.
SP143 him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-31(mn31) unc-4(e120) II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc, L1 Lethal Unc-4s and males. Maintain by picking WT.
SP144 him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-32(mn32) II. C. elegans Hets are WT and segregate WT, dead eggs, paralysed DpyUnc and males. Maintain by picking WT.
SP152 him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/zyg-11(mn40) unc-4(e120) II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc, Sterile Unc-4, and males. Maintain by picking WT.
SP158 spe-1(mn47) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT.
SP174 sqv-8(mn63) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT. mn63 pka spe-2. See also WBPaper00003405 and #3406.
SP198 let-262(mn87) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Het are WT and segregate WT, paralysed DpyUnc, and dead eggs. Maintain by picking WT.
SP199 let-236(mn88) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregates WT, paralysed DpyUnc, and larvae which are arrested. Pick L1-L2 Unc-4's to check for larval lethal phenotype. Maintain strain by picking WT
SP201 unc-4(e120) let-242(mn90)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Pick WT to maintain. Hets segregate WT, DpyUncs, and lethals (early larval arrest).
SP204 let-239(mn93) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUncs, and dead eggs. Pick WT to maintain.
SP206 unc-4(e120) let-251(mn95)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP208 unc-4(e120) let-244(mn97)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, dead eggs and paralysed DpyUnc. Maintain by picking WT.
SP210 unc-4(e120) let-246(mn99)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and early larval lethals which are Unc. Maintain by picking WT.
SP211 let-252(mn100) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP212 let-253(mn181) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, DpyUnc and UncLets. Lethal early larval. Maintain by picking WT.
SP216 unc-4(e120) let-245(mn185)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP281 unc-4(e120) let-268(mn189)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc, and Lets.
SP286 unc-4(e120) let-266(mn194)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and lets.
SP306 mnC1 [dpy-10(e128) unc-52(e444)/unc-4(e120) unc-52(e444)] II; mnDp34 (II;f). C. elegans Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).
SP307 mnC1 [dpy-10(e128) unc-52(e444)/unc-4(e120) unc-52(e444)] II; mnDp35 (II;f). C. elegans Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).
SP308 mnC1 [dpy-10(e128) unc-52(e444)/unc-4(e120) unc-52(e444)] II; mnDp36 (II;f). C. elegans Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).
SP354 unc-4(e120) mnDf71/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP355 unc-4(e120) let-25(mn25)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc, and early larval Unc-4. Maintain by picking WT.
SP364 let-19(mn19) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc, and early larval Unc-4. Maintain by picking WT.
SP365 unc-4(e120) mix-1(mn29)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and late larval Unc-4. Maintain by picking WT. mn29 pka let-29(mn29). See also WBPaper00002999.
SP371 unc-4(e120) let-26(mn26)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and early larval Unc-4. Maintain by picking WT.
SP373 unc-4(e120) let-27(mn27)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and early larval Unc-4. Maintain by picking WT.
SP377 let-22(mn22) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and early larval lethals.
SP378 let-23(mn23) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and early larval Unc-4. Maintain by picking WT.
SP379 let-24(mn24) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, DpyUnc and early larval Unc-4. Maintain by picking WT.
SP424 mnDf12/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs (some early larval lethals). Maintain by picking WT.
SP425 mnDf14/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, DpyUnc and kinker Uncs which arrest as L1s. Maintain by picking WT.
SP426 mnDf16/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP427 mnDf22/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Manintain by picking WT.
SP428 mnDf24/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP429 mnDf25/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP430 mnDf26/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP432 unc-4(e120) ooc-3(mn241)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and Sterile Unc-4's. ooc-3 homozygotes lay fertilized eggs that do not hatch. Oocytes not rescuable by fertilization with N2 sperm.
SP433 unc-4(e120) ooc-1(mn250)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and Sterile Unc-4's. ooc-1 homozygotes lay fertilized eggs that do not hatch. Oocytes are not rescuable by fertilization with N2 sperm.
SP444 unc-4(e120) spe-7(mn252)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Paralyzed Dpys and Uncs which are sterile.
SP445 ooc-2(mn249) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and Sterile Unc-4's. ooc-2 homozygotes lay fertilized eggs that do not hatch. Oocytes not rescuable by fertilization with N2 sperm.
SP540 mnDf27/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP541 mnDf28/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed DpyUnc and dead eggs (some early larval lethals). Maintain by picking WT.
SP542 mnDf29/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Hets are WT and segregate WT, paralysed Dpyunc and dead eggs. Maintain by picking WT.